FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635200_at:

>probe:Drosophila_2:1635200_at:157:365; Interrogation_Position=1630; Antisense; GAATCAGTCGGTCTATATTCTCGAG
>probe:Drosophila_2:1635200_at:369:21; Interrogation_Position=1644; Antisense; ATATTCTCGAGGTAAGCACTTTGCA
>probe:Drosophila_2:1635200_at:46:113; Interrogation_Position=1658; Antisense; AGCACTTTGCAAATGGCCGTTCTGA
>probe:Drosophila_2:1635200_at:218:69; Interrogation_Position=1670; Antisense; ATGGCCGTTCTGATGCTATTCAATC
>probe:Drosophila_2:1635200_at:54:271; Interrogation_Position=1697; Antisense; CATGAACGATTTACGGAGCAGGAAT
>probe:Drosophila_2:1635200_at:721:691; Interrogation_Position=1732; Antisense; TTTGGGAGTCGAGCTGGAGACCCTC
>probe:Drosophila_2:1635200_at:54:287; Interrogation_Position=1745; Antisense; CTGGAGACCCTCCAAGAGGCATTAA
>probe:Drosophila_2:1635200_at:273:391; Interrogation_Position=1846; Antisense; GAAACGCCGACTCTTCTGCAATGAG
>probe:Drosophila_2:1635200_at:580:609; Interrogation_Position=1867; Antisense; TGAGCCCCTGCCCAGAAAAATGAGA
>probe:Drosophila_2:1635200_at:184:621; Interrogation_Position=1948; Antisense; TGCTGCAATAGTGCGCATTATGAAA
>probe:Drosophila_2:1635200_at:116:17; Interrogation_Position=2003; Antisense; ATTTCACTCGTTTATGAGGAGCTTA
>probe:Drosophila_2:1635200_at:129:89; Interrogation_Position=2029; Antisense; AGATCGGGTAAAGCCACAAGTGAGT
>probe:Drosophila_2:1635200_at:249:183; Interrogation_Position=2063; Antisense; AAAAGACTTGACTACCTGGTGGAGC
>probe:Drosophila_2:1635200_at:248:403; Interrogation_Position=2072; Antisense; GACTACCTGGTGGAGCGTGAATATT

Paste this into a BLAST search page for me
GAATCAGTCGGTCTATATTCTCGAGATATTCTCGAGGTAAGCACTTTGCAAGCACTTTGCAAATGGCCGTTCTGAATGGCCGTTCTGATGCTATTCAATCCATGAACGATTTACGGAGCAGGAATTTTGGGAGTCGAGCTGGAGACCCTCCTGGAGACCCTCCAAGAGGCATTAAGAAACGCCGACTCTTCTGCAATGAGTGAGCCCCTGCCCAGAAAAATGAGATGCTGCAATAGTGCGCATTATGAAAATTTCACTCGTTTATGAGGAGCTTAAGATCGGGTAAAGCCACAAGTGAGTAAAAGACTTGACTACCTGGTGGAGCGACTACCTGGTGGAGCGTGAATATT

Full Affymetrix probeset data:

Annotations for 1635200_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720