Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635201_at:

>probe:Drosophila_2:1635201_at:342:557; Interrogation_Position=5484; Antisense; GGACTTCAATGTCACGGATGCCAAG
>probe:Drosophila_2:1635201_at:418:247; Interrogation_Position=5515; Antisense; GACAAAAAGTTCTCCTTCTGGGCTG
>probe:Drosophila_2:1635201_at:96:145; Interrogation_Position=5636; Antisense; ACTCCTTTGACCTGGACACTATGGT
>probe:Drosophila_2:1635201_at:504:223; Interrogation_Position=5686; Antisense; AAGGACCGACGCCTAATCGAGGAAT
>probe:Drosophila_2:1635201_at:573:599; Interrogation_Position=5723; Antisense; TGAACCGTTCCGTTTATCCAGACCA
>probe:Drosophila_2:1635201_at:614:215; Interrogation_Position=5770; Antisense; AAGATCTTCTCAGGCTGCTTGTCCA
>probe:Drosophila_2:1635201_at:450:619; Interrogation_Position=5785; Antisense; TGCTTGTCCAACTATTCCGGAGTGG
>probe:Drosophila_2:1635201_at:11:141; Interrogation_Position=5810; Antisense; ACGTGACCATGGTTGGGCTCTTTAA
>probe:Drosophila_2:1635201_at:240:711; Interrogation_Position=5831; Antisense; TTAAGCCGGAGTCGCGGTTCTACAA
>probe:Drosophila_2:1635201_at:419:453; Interrogation_Position=5860; Antisense; GATCAGCACGTGGAGGACTACCTCT
>probe:Drosophila_2:1635201_at:563:673; Interrogation_Position=5878; Antisense; TACCTCTTCATCGATTTGCACATGG
>probe:Drosophila_2:1635201_at:210:509; Interrogation_Position=5932; Antisense; GTGCTCGTATCCTAGTGAAGTCCTT
>probe:Drosophila_2:1635201_at:381:517; Interrogation_Position=5977; Antisense; GTGGGTTTCATTCCATTCGGAGTGT
>probe:Drosophila_2:1635201_at:412:525; Interrogation_Position=6006; Antisense; GGGCTTCTTAGTCTTATGTGCAGTA

Paste this into a BLAST search page for me
GGACTTCAATGTCACGGATGCCAAGGACAAAAAGTTCTCCTTCTGGGCTGACTCCTTTGACCTGGACACTATGGTAAGGACCGACGCCTAATCGAGGAATTGAACCGTTCCGTTTATCCAGACCAAAGATCTTCTCAGGCTGCTTGTCCATGCTTGTCCAACTATTCCGGAGTGGACGTGACCATGGTTGGGCTCTTTAATTAAGCCGGAGTCGCGGTTCTACAAGATCAGCACGTGGAGGACTACCTCTTACCTCTTCATCGATTTGCACATGGGTGCTCGTATCCTAGTGAAGTCCTTGTGGGTTTCATTCCATTCGGAGTGTGGGCTTCTTAGTCTTATGTGCAGTA

Full Affymetrix probeset data:

Annotations for 1635201_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime