FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635203_at:

>probe:Drosophila_2:1635203_at:730:565; Interrogation_Position=278; Antisense; GGCAGTGCCGTTTCCGTACGAGGAA
>probe:Drosophila_2:1635203_at:131:437; Interrogation_Position=321; Antisense; GAGGAGCCCCAACAAGTGGCTTCCA
>probe:Drosophila_2:1635203_at:92:585; Interrogation_Position=337; Antisense; TGGCTTCCACTTCGCATGAGAGCTA
>probe:Drosophila_2:1635203_at:432:609; Interrogation_Position=383; Antisense; TGAGCTCAGCATCAACAATGTGGAC
>probe:Drosophila_2:1635203_at:653:61; Interrogation_Position=400; Antisense; ATGTGGACACTACCTCAGTTACTAC
>probe:Drosophila_2:1635203_at:698:247; Interrogation_Position=425; Antisense; AATTGACGCAGTCCACGATAGTCCA
>probe:Drosophila_2:1635203_at:468:379; Interrogation_Position=455; Antisense; GAAGCGCCCGAAGGAATCTTCCATT
>probe:Drosophila_2:1635203_at:125:367; Interrogation_Position=468; Antisense; GAATCTTCCATTGTCATTGCTCTAA
>probe:Drosophila_2:1635203_at:49:379; Interrogation_Position=495; Antisense; GAAGCTGTGAAAATGGAACCCAATC
>probe:Drosophila_2:1635203_at:199:381; Interrogation_Position=510; Antisense; GAACCCAATCCGAATGCAGGCCGAG
>probe:Drosophila_2:1635203_at:536:577; Interrogation_Position=528; Antisense; GGCCGAGTTAGAGCAGAACCCGACA
>probe:Drosophila_2:1635203_at:178:83; Interrogation_Position=569; Antisense; AGTGTCTGTGTTCAACTTCAAGGGA
>probe:Drosophila_2:1635203_at:31:107; Interrogation_Position=691; Antisense; AGAAACATATTTCCCACCTTGACCT
>probe:Drosophila_2:1635203_at:486:493; Interrogation_Position=730; Antisense; GTAATACATGTTGTTCTTCTGTCAA

Paste this into a BLAST search page for me
GGCAGTGCCGTTTCCGTACGAGGAAGAGGAGCCCCAACAAGTGGCTTCCATGGCTTCCACTTCGCATGAGAGCTATGAGCTCAGCATCAACAATGTGGACATGTGGACACTACCTCAGTTACTACAATTGACGCAGTCCACGATAGTCCAGAAGCGCCCGAAGGAATCTTCCATTGAATCTTCCATTGTCATTGCTCTAAGAAGCTGTGAAAATGGAACCCAATCGAACCCAATCCGAATGCAGGCCGAGGGCCGAGTTAGAGCAGAACCCGACAAGTGTCTGTGTTCAACTTCAAGGGAAGAAACATATTTCCCACCTTGACCTGTAATACATGTTGTTCTTCTGTCAA

Full Affymetrix probeset data:

Annotations for 1635203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720