FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635204_at:

>probe:Drosophila_2:1635204_at:724:371; Interrogation_Position=121; Antisense; GAAGGTGTCATCGACGAGCCCATTT
>probe:Drosophila_2:1635204_at:546:251; Interrogation_Position=153; Antisense; CAAGTGCAAGTTCCCCAGCGAGAGT
>probe:Drosophila_2:1635204_at:214:579; Interrogation_Position=207; Antisense; GGCCTGCATGTCTATCATCCGGAAA
>probe:Drosophila_2:1635204_at:215:35; Interrogation_Position=220; Antisense; ATCATCCGGAAAGGGTTTGCAACCA
>probe:Drosophila_2:1635204_at:551:137; Interrogation_Position=257; Antisense; ACGTCGGTAGCAGTACGGTTTGCCT
>probe:Drosophila_2:1635204_at:605:313; Interrogation_Position=282; Antisense; GCCATCCTGCGTGGAGCAGCAGATA
>probe:Drosophila_2:1635204_at:122:131; Interrogation_Position=364; Antisense; ACCGAAATTCAAATAGCCTCTCCAC
>probe:Drosophila_2:1635204_at:262:219; Interrogation_Position=410; Antisense; AAGTCACCCAGACCAAGCTGGATCT
>probe:Drosophila_2:1635204_at:312:333; Interrogation_Position=426; Antisense; GCTGGATCTAATAGTCGGCATCGGA
>probe:Drosophila_2:1635204_at:220:221; Interrogation_Position=450; Antisense; AAGTGTGGCAGGACTCTTCTTCGGC
>probe:Drosophila_2:1635204_at:493:711; Interrogation_Position=46; Antisense; TTCAATTCCTTGACCTATACCATCT
>probe:Drosophila_2:1635204_at:439:301; Interrogation_Position=479; Antisense; CCCTGCTGAACCTACTGGAGATCAT
>probe:Drosophila_2:1635204_at:143:287; Interrogation_Position=493; Antisense; CTGGAGATCATTTCGTACTTCATTA
>probe:Drosophila_2:1635204_at:406:189; Interrogation_Position=84; Antisense; AACATACGCCTTCAACGTCGAGGAG

Paste this into a BLAST search page for me
GAAGGTGTCATCGACGAGCCCATTTCAAGTGCAAGTTCCCCAGCGAGAGTGGCCTGCATGTCTATCATCCGGAAAATCATCCGGAAAGGGTTTGCAACCAACGTCGGTAGCAGTACGGTTTGCCTGCCATCCTGCGTGGAGCAGCAGATAACCGAAATTCAAATAGCCTCTCCACAAGTCACCCAGACCAAGCTGGATCTGCTGGATCTAATAGTCGGCATCGGAAAGTGTGGCAGGACTCTTCTTCGGCTTCAATTCCTTGACCTATACCATCTCCCTGCTGAACCTACTGGAGATCATCTGGAGATCATTTCGTACTTCATTAAACATACGCCTTCAACGTCGAGGAG

Full Affymetrix probeset data:

Annotations for 1635204_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720