FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635205_at:

>probe:Drosophila_2:1635205_at:23:137; Interrogation_Position=1014; Antisense; ACGAAAGTGTTCTCAAGTCTCATGA
>probe:Drosophila_2:1635205_at:549:165; Interrogation_Position=1039; Antisense; AAATGTTCACCGTGGCATCAAGCCC
>probe:Drosophila_2:1635205_at:68:515; Interrogation_Position=1076; Antisense; GTGTGCGACAAAGCGTTTGCCTACG
>probe:Drosophila_2:1635205_at:248:557; Interrogation_Position=1135; Antisense; GGACATCAAACTGTACCGCTGCGAT
>probe:Drosophila_2:1635205_at:70:723; Interrogation_Position=1162; Antisense; TTGCAACAAGGACTTCCGTCTGCTG
>probe:Drosophila_2:1635205_at:21:261; Interrogation_Position=1202; Antisense; CACGAGGAGACCAAACTGCACCAGA
>probe:Drosophila_2:1635205_at:186:201; Interrogation_Position=1226; Antisense; AACGCCGTAATGCTGGCCGAGAGCA
>probe:Drosophila_2:1635205_at:242:449; Interrogation_Position=1291; Antisense; GATCCGAATTCAAGCTCACTGACGC
>probe:Drosophila_2:1635205_at:705:419; Interrogation_Position=863; Antisense; GAGCATCGCAGACGCCATGACGGCA
>probe:Drosophila_2:1635205_at:671:141; Interrogation_Position=882; Antisense; ACGGCATCTGCCAATATGCATGCGA
>probe:Drosophila_2:1635205_at:146:683; Interrogation_Position=909; Antisense; TATGCGATGCCAAGTTCCAGGTGCG
>probe:Drosophila_2:1635205_at:729:281; Interrogation_Position=941; Antisense; CTGAGGAAGCACATGTACTCCCACA
>probe:Drosophila_2:1635205_at:644:199; Interrogation_Position=975; Antisense; AACCCTATAAGTGCAGCTTCTGCAG
>probe:Drosophila_2:1635205_at:470:343; Interrogation_Position=990; Antisense; GCTTCTGCAGTCGTCAATTCTTCTA

Paste this into a BLAST search page for me
ACGAAAGTGTTCTCAAGTCTCATGAAAATGTTCACCGTGGCATCAAGCCCGTGTGCGACAAAGCGTTTGCCTACGGGACATCAAACTGTACCGCTGCGATTTGCAACAAGGACTTCCGTCTGCTGCACGAGGAGACCAAACTGCACCAGAAACGCCGTAATGCTGGCCGAGAGCAGATCCGAATTCAAGCTCACTGACGCGAGCATCGCAGACGCCATGACGGCAACGGCATCTGCCAATATGCATGCGATATGCGATGCCAAGTTCCAGGTGCGCTGAGGAAGCACATGTACTCCCACAAACCCTATAAGTGCAGCTTCTGCAGGCTTCTGCAGTCGTCAATTCTTCTA

Full Affymetrix probeset data:

Annotations for 1635205_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720