FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635207_at:

>probe:Drosophila_2:1635207_at:462:35; Interrogation_Position=1542; Antisense; ATCAGCTTCAGCATGCCCAAGATGT
>probe:Drosophila_2:1635207_at:576:99; Interrogation_Position=1561; Antisense; AGATGTCGCTGCTGCAGACGCGCAA
>probe:Drosophila_2:1635207_at:28:237; Interrogation_Position=1611; Antisense; AATCGCTCCCAACAGGCGGATCTTG
>probe:Drosophila_2:1635207_at:67:545; Interrogation_Position=1628; Antisense; GGATCTTGGTTTCAATTGCCGCCAG
>probe:Drosophila_2:1635207_at:631:647; Interrogation_Position=1661; Antisense; TCAGTGCTCCAACGTCATCCAGGTG
>probe:Drosophila_2:1635207_at:512:81; Interrogation_Position=1699; Antisense; AGGTGGAGTTCGTCATCTCCAGCCT
>probe:Drosophila_2:1635207_at:36:665; Interrogation_Position=1758; Antisense; TACACATTCCGTGTCGTCGGGATGG
>probe:Drosophila_2:1635207_at:512:97; Interrogation_Position=1819; Antisense; AGATCGACAAGAAGACGCCGCTGCC
>probe:Drosophila_2:1635207_at:427:167; Interrogation_Position=1854; Antisense; AAAGGTGCTCCGCTGAAGGACTCCG
>probe:Drosophila_2:1635207_at:431:449; Interrogation_Position=1904; Antisense; GATCCTGCGGTTCTACTCGAACAGT
>probe:Drosophila_2:1635207_at:3:385; Interrogation_Position=1922; Antisense; GAACAGTCCCGGCTACTGGATGTTC
>probe:Drosophila_2:1635207_at:462:589; Interrogation_Position=1938; Antisense; TGGATGTTCCACTGTCACATATCGC
>probe:Drosophila_2:1635207_at:357:215; Interrogation_Position=2019; Antisense; AAGATGTGCCCGGTGAGCAACTGCG
>probe:Drosophila_2:1635207_at:262:287; Interrogation_Position=2075; Antisense; CTGGGTCCCGAAGTTATCACTCAAA

Paste this into a BLAST search page for me
ATCAGCTTCAGCATGCCCAAGATGTAGATGTCGCTGCTGCAGACGCGCAAAATCGCTCCCAACAGGCGGATCTTGGGATCTTGGTTTCAATTGCCGCCAGTCAGTGCTCCAACGTCATCCAGGTGAGGTGGAGTTCGTCATCTCCAGCCTTACACATTCCGTGTCGTCGGGATGGAGATCGACAAGAAGACGCCGCTGCCAAAGGTGCTCCGCTGAAGGACTCCGGATCCTGCGGTTCTACTCGAACAGTGAACAGTCCCGGCTACTGGATGTTCTGGATGTTCCACTGTCACATATCGCAAGATGTGCCCGGTGAGCAACTGCGCTGGGTCCCGAAGTTATCACTCAAA

Full Affymetrix probeset data:

Annotations for 1635207_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720