FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635208_at:

>probe:Drosophila_2:1635208_at:253:409; Interrogation_Position=4196; Antisense; GACGCACCCGATGAGTTCAAGGATC
>probe:Drosophila_2:1635208_at:232:441; Interrogation_Position=4225; Antisense; GATGGACACGCTAATGTCGGACCCC
>probe:Drosophila_2:1635208_at:603:587; Interrogation_Position=4275; Antisense; TGGATCGGGCGATTATTACCCGCCA
>probe:Drosophila_2:1635208_at:649:311; Interrogation_Position=4296; Antisense; GCCACTTGCTCAACAGCTGCACGGA
>probe:Drosophila_2:1635208_at:361:259; Interrogation_Position=4342; Antisense; CACCGAGGACATGCTGGTGGCCAAC
>probe:Drosophila_2:1635208_at:524:419; Interrogation_Position=4403; Antisense; GAGCAGCGTGGCAAGCGGAACAATT
>probe:Drosophila_2:1635208_at:348:561; Interrogation_Position=4419; Antisense; GGAACAATTGCTAAGTCGCGCACCC
>probe:Drosophila_2:1635208_at:111:697; Interrogation_Position=4444; Antisense; TTTAACCCATACTGCTATACTTAGG
>probe:Drosophila_2:1635208_at:363:657; Interrogation_Position=4476; Antisense; TAATGTGCAGTTTTAGTGTCTACCT
>probe:Drosophila_2:1635208_at:167:83; Interrogation_Position=4490; Antisense; AGTGTCTACCTATCTTCTACATATA
>probe:Drosophila_2:1635208_at:573:301; Interrogation_Position=4560; Antisense; CCGATTTTTGGGTGGCCTGCAAGTA
>probe:Drosophila_2:1635208_at:521:89; Interrogation_Position=4581; Antisense; AGTAGCAGTTACCATTAATCACCGC
>probe:Drosophila_2:1635208_at:180:3; Interrogation_Position=4594; Antisense; ATTAATCACCGCTCCCGTTAGGAGT
>probe:Drosophila_2:1635208_at:720:357; Interrogation_Position=4658; Antisense; GCAAATCTTTCGTTGTTTTTCTACT

Paste this into a BLAST search page for me
GACGCACCCGATGAGTTCAAGGATCGATGGACACGCTAATGTCGGACCCCTGGATCGGGCGATTATTACCCGCCAGCCACTTGCTCAACAGCTGCACGGACACCGAGGACATGCTGGTGGCCAACGAGCAGCGTGGCAAGCGGAACAATTGGAACAATTGCTAAGTCGCGCACCCTTTAACCCATACTGCTATACTTAGGTAATGTGCAGTTTTAGTGTCTACCTAGTGTCTACCTATCTTCTACATATACCGATTTTTGGGTGGCCTGCAAGTAAGTAGCAGTTACCATTAATCACCGCATTAATCACCGCTCCCGTTAGGAGTGCAAATCTTTCGTTGTTTTTCTACT

Full Affymetrix probeset data:

Annotations for 1635208_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720