FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635211_at:

>probe:Drosophila_2:1635211_at:191:365; Interrogation_Position=7570; Antisense; GAATCAAACTCGATACTGTAGTGTG
>probe:Drosophila_2:1635211_at:375:709; Interrogation_Position=7734; Antisense; TTAATTATCCTTATCTGTGTTGCGG
>probe:Drosophila_2:1635211_at:87:419; Interrogation_Position=7762; Antisense; GAGCTGCGCGGGATTTGCATCTAAA
>probe:Drosophila_2:1635211_at:144:661; Interrogation_Position=7783; Antisense; TAAAAGACAAATTGGGCGCGCCGCC
>probe:Drosophila_2:1635211_at:648:299; Interrogation_Position=7801; Antisense; CGCCGCCCATTCAATTCTTATAAAT
>probe:Drosophila_2:1635211_at:683:39; Interrogation_Position=7857; Antisense; ATCTGTGTGTGTACTACTCGTATCC
>probe:Drosophila_2:1635211_at:162:667; Interrogation_Position=7871; Antisense; TACTCGTATCCGTAGTTTCTACTTT
>probe:Drosophila_2:1635211_at:8:477; Interrogation_Position=7885; Antisense; GTTTCTACTTTATAAGTTCTCCGTG
>probe:Drosophila_2:1635211_at:345:217; Interrogation_Position=7898; Antisense; AAGTTCTCCGTGAATGACTACGATG
>probe:Drosophila_2:1635211_at:95:139; Interrogation_Position=7917; Antisense; ACGATGAATTTTTCGGCCAGCAGCC
>probe:Drosophila_2:1635211_at:39:487; Interrogation_Position=8075; Antisense; GTAGTAATTCACTAGCCGCTTCATA
>probe:Drosophila_2:1635211_at:483:343; Interrogation_Position=8092; Antisense; GCTTCATAGACTCTACACGCGTGAT
>probe:Drosophila_2:1635211_at:232:667; Interrogation_Position=8105; Antisense; TACACGCGTGATTTATGGCACTTAA
>probe:Drosophila_2:1635211_at:480:581; Interrogation_Position=8120; Antisense; TGGCACTTAATGTTCTGTAGCCTAA

Paste this into a BLAST search page for me
GAATCAAACTCGATACTGTAGTGTGTTAATTATCCTTATCTGTGTTGCGGGAGCTGCGCGGGATTTGCATCTAAATAAAAGACAAATTGGGCGCGCCGCCCGCCGCCCATTCAATTCTTATAAATATCTGTGTGTGTACTACTCGTATCCTACTCGTATCCGTAGTTTCTACTTTGTTTCTACTTTATAAGTTCTCCGTGAAGTTCTCCGTGAATGACTACGATGACGATGAATTTTTCGGCCAGCAGCCGTAGTAATTCACTAGCCGCTTCATAGCTTCATAGACTCTACACGCGTGATTACACGCGTGATTTATGGCACTTAATGGCACTTAATGTTCTGTAGCCTAA

Full Affymetrix probeset data:

Annotations for 1635211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720