FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635213_at:

>probe:Drosophila_2:1635213_at:452:569; Interrogation_Position=142; Antisense; GGCTAGTGGTACACGAACCCTATTT
>probe:Drosophila_2:1635213_at:126:239; Interrogation_Position=175; Antisense; AATACTTCTAACTGCGCCTGGATTA
>probe:Drosophila_2:1635213_at:714:249; Interrogation_Position=211; Antisense; CAATGACTTTTCTTCACTTCACGTA
>probe:Drosophila_2:1635213_at:610:493; Interrogation_Position=233; Antisense; GTAATATCAGAGGTTCGCCTGCCTA
>probe:Drosophila_2:1635213_at:133:317; Interrogation_Position=249; Antisense; GCCTGCCTAAGGAAGTTTTGCCTCT
>probe:Drosophila_2:1635213_at:86:719; Interrogation_Position=266; Antisense; TTGCCTCTAAGCTATGAAGTCCTCA
>probe:Drosophila_2:1635213_at:486:373; Interrogation_Position=281; Antisense; GAAGTCCTCATTGAACCGCATATGG
>probe:Drosophila_2:1635213_at:157:171; Interrogation_Position=364; Antisense; AAAGGTGTATTTCCATGCACATGAC
>probe:Drosophila_2:1635213_at:621:157; Interrogation_Position=387; Antisense; ACACTTTGTTGATCGACGTCAGCCA
>probe:Drosophila_2:1635213_at:659:141; Interrogation_Position=484; Antisense; ACTGCCTCGAAAGCCTGTATTTGTT
>probe:Drosophila_2:1635213_at:722:221; Interrogation_Position=533; Antisense; AAGGGCTCGGAATGTCTTTTAGACA
>probe:Drosophila_2:1635213_at:714:377; Interrogation_Position=603; Antisense; GAAGCTATTACACCAATTCTGGCAA
>probe:Drosophila_2:1635213_at:444:709; Interrogation_Position=660; Antisense; TTAAACCAAACAATGCACGCCGATT
>probe:Drosophila_2:1635213_at:341:261; Interrogation_Position=675; Antisense; CACGCCGATTATTTCCATGCTTTGA

Paste this into a BLAST search page for me
GGCTAGTGGTACACGAACCCTATTTAATACTTCTAACTGCGCCTGGATTACAATGACTTTTCTTCACTTCACGTAGTAATATCAGAGGTTCGCCTGCCTAGCCTGCCTAAGGAAGTTTTGCCTCTTTGCCTCTAAGCTATGAAGTCCTCAGAAGTCCTCATTGAACCGCATATGGAAAGGTGTATTTCCATGCACATGACACACTTTGTTGATCGACGTCAGCCAACTGCCTCGAAAGCCTGTATTTGTTAAGGGCTCGGAATGTCTTTTAGACAGAAGCTATTACACCAATTCTGGCAATTAAACCAAACAATGCACGCCGATTCACGCCGATTATTTCCATGCTTTGA

Full Affymetrix probeset data:

Annotations for 1635213_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720