Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635214_at:

>probe:Drosophila_2:1635214_at:287:373; Interrogation_Position=5614; Antisense; GAAGTGACGCAGGACCTCCGCAACA
>probe:Drosophila_2:1635214_at:471:595; Interrogation_Position=5651; Antisense; TGTGCTACGGAATCGTCTACGGCAT
>probe:Drosophila_2:1635214_at:135:581; Interrogation_Position=5690; Antisense; TGGCCGAGTCGTTAAACTGCAGTGA
>probe:Drosophila_2:1635214_at:674:603; Interrogation_Position=5729; Antisense; TGATATCCGATCAGTTTCACCAGGC
>probe:Drosophila_2:1635214_at:575:481; Interrogation_Position=5762; Antisense; GTATTCGCGATTACACCACGAGGGT
>probe:Drosophila_2:1635214_at:618:531; Interrogation_Position=5783; Antisense; GGGTGGTCAATTTCGCACGCAGCAA
>probe:Drosophila_2:1635214_at:591:413; Interrogation_Position=5820; Antisense; GACCATTACTGGACGGCGACGGTAT
>probe:Drosophila_2:1635214_at:363:129; Interrogation_Position=5911; Antisense; ACCATCCAAGGATCGGCTGCGGATA
>probe:Drosophila_2:1635214_at:302:381; Interrogation_Position=5974; Antisense; GAACGTTATCGCGAAAAGCTGGCAT
>probe:Drosophila_2:1635214_at:391:413; Interrogation_Position=6016; Antisense; GACCTGGTAATGCACCTACATGACG
>probe:Drosophila_2:1635214_at:400:163; Interrogation_Position=6077; Antisense; AAATAGCCAAAGTCCTTAGCCTCAC
>probe:Drosophila_2:1635214_at:372:707; Interrogation_Position=6092; Antisense; TTAGCCTCACCATGGAGAACTGCGT
>probe:Drosophila_2:1635214_at:552:383; Interrogation_Position=6108; Antisense; GAACTGCGTGAAACTCAGCGTGCCA
>probe:Drosophila_2:1635214_at:70:649; Interrogation_Position=6122; Antisense; TCAGCGTGCCACTCAAGGTGAAGCT

Paste this into a BLAST search page for me
GAAGTGACGCAGGACCTCCGCAACATGTGCTACGGAATCGTCTACGGCATTGGCCGAGTCGTTAAACTGCAGTGATGATATCCGATCAGTTTCACCAGGCGTATTCGCGATTACACCACGAGGGTGGGTGGTCAATTTCGCACGCAGCAAGACCATTACTGGACGGCGACGGTATACCATCCAAGGATCGGCTGCGGATAGAACGTTATCGCGAAAAGCTGGCATGACCTGGTAATGCACCTACATGACGAAATAGCCAAAGTCCTTAGCCTCACTTAGCCTCACCATGGAGAACTGCGTGAACTGCGTGAAACTCAGCGTGCCATCAGCGTGCCACTCAAGGTGAAGCT

Full Affymetrix probeset data:

Annotations for 1635214_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime