FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635215_at:

>probe:Drosophila_2:1635215_at:126:681; Interrogation_Position=348; Antisense; TATGGAGCAGCGCAGTCATCCGAAT
>probe:Drosophila_2:1635215_at:621:79; Interrogation_Position=403; Antisense; AGGTCCATGATGTACTTCGCTCGAA
>probe:Drosophila_2:1635215_at:490:559; Interrogation_Position=507; Antisense; GGAAATTTTCGACGCGATGGTCTCC
>probe:Drosophila_2:1635215_at:288:209; Interrogation_Position=546; Antisense; AAGCATGTCCATGTCTGAGGGCAGG
>probe:Drosophila_2:1635215_at:168:391; Interrogation_Position=594; Antisense; GAAAGCCACCGAAGACGAGACCGTT
>probe:Drosophila_2:1635215_at:294:425; Interrogation_Position=610; Antisense; GAGACCGTTGACTTTATCATGCTGA
>probe:Drosophila_2:1635215_at:56:389; Interrogation_Position=641; Antisense; GAAAAAATCCTGACACCGGCGCTTT
>probe:Drosophila_2:1635215_at:10:617; Interrogation_Position=676; Antisense; TGCAATGCCCATGTTCTTCGTGAAT
>probe:Drosophila_2:1635215_at:186:655; Interrogation_Position=729; Antisense; TAATTTGGAGGAACTGCCGCCGTAC
>probe:Drosophila_2:1635215_at:227:555; Interrogation_Position=757; Antisense; GGACCCACTACGTTCATTTGCGGCA
>probe:Drosophila_2:1635215_at:152:455; Interrogation_Position=785; Antisense; GATCACCTTACATGAGACGCGAGCA
>probe:Drosophila_2:1635215_at:730:309; Interrogation_Position=836; Antisense; CCAATTCTGAGATCCACTGGCTGGA
>probe:Drosophila_2:1635215_at:321:547; Interrogation_Position=858; Antisense; GGATGCCGGACATTTAGTGCACTTT
>probe:Drosophila_2:1635215_at:513:181; Interrogation_Position=884; Antisense; AAAAGCCGCAGGAGTTTCTAACAAT

Paste this into a BLAST search page for me
TATGGAGCAGCGCAGTCATCCGAATAGGTCCATGATGTACTTCGCTCGAAGGAAATTTTCGACGCGATGGTCTCCAAGCATGTCCATGTCTGAGGGCAGGGAAAGCCACCGAAGACGAGACCGTTGAGACCGTTGACTTTATCATGCTGAGAAAAAATCCTGACACCGGCGCTTTTGCAATGCCCATGTTCTTCGTGAATTAATTTGGAGGAACTGCCGCCGTACGGACCCACTACGTTCATTTGCGGCAGATCACCTTACATGAGACGCGAGCACCAATTCTGAGATCCACTGGCTGGAGGATGCCGGACATTTAGTGCACTTTAAAAGCCGCAGGAGTTTCTAACAAT

Full Affymetrix probeset data:

Annotations for 1635215_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720