Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635216_at:

>probe:Drosophila_2:1635216_at:132:399; Interrogation_Position=1293; Antisense; GACACGGAATCTTTGCTAGGATATC
>probe:Drosophila_2:1635216_at:311:459; Interrogation_Position=1312; Antisense; GATATCACAGCGATACGCGCATCGA
>probe:Drosophila_2:1635216_at:510:297; Interrogation_Position=1329; Antisense; CGCATCGAGTTGGAGGAGGACTTTC
>probe:Drosophila_2:1635216_at:388:549; Interrogation_Position=1343; Antisense; GGAGGACTTTCTGCCAGAGCCGCGA
>probe:Drosophila_2:1635216_at:702:101; Interrogation_Position=1358; Antisense; AGAGCCGCGATTTCAAGACTCGATT
>probe:Drosophila_2:1635216_at:507:405; Interrogation_Position=1374; Antisense; GACTCGATTCCATAGCTAATCATGA
>probe:Drosophila_2:1635216_at:67:415; Interrogation_Position=1397; Antisense; GACCAGCGACAATGTAGCTACATAT
>probe:Drosophila_2:1635216_at:488:461; Interrogation_Position=1432; Antisense; GATTCAGTTGTGAAGCCTCCTTACG
>probe:Drosophila_2:1635216_at:213:317; Interrogation_Position=1446; Antisense; GCCTCCTTACGACATACATATACTT
>probe:Drosophila_2:1635216_at:16:435; Interrogation_Position=1488; Antisense; GAGGTACAGACAGTCCATCCTATAG
>probe:Drosophila_2:1635216_at:26:247; Interrogation_Position=1617; Antisense; AATTCTTGCTTGGACATTCGAGTTT
>probe:Drosophila_2:1635216_at:416:337; Interrogation_Position=1728; Antisense; GCTCGTTATAGCTCGCGTCAACAAA
>probe:Drosophila_2:1635216_at:379:389; Interrogation_Position=1801; Antisense; GAAACTTTAAGCAACACATACGGAT
>probe:Drosophila_2:1635216_at:707:245; Interrogation_Position=1846; Antisense; AATTCCAACTATTCCCATTAATCGA

Paste this into a BLAST search page for me
GACACGGAATCTTTGCTAGGATATCGATATCACAGCGATACGCGCATCGACGCATCGAGTTGGAGGAGGACTTTCGGAGGACTTTCTGCCAGAGCCGCGAAGAGCCGCGATTTCAAGACTCGATTGACTCGATTCCATAGCTAATCATGAGACCAGCGACAATGTAGCTACATATGATTCAGTTGTGAAGCCTCCTTACGGCCTCCTTACGACATACATATACTTGAGGTACAGACAGTCCATCCTATAGAATTCTTGCTTGGACATTCGAGTTTGCTCGTTATAGCTCGCGTCAACAAAGAAACTTTAAGCAACACATACGGATAATTCCAACTATTCCCATTAATCGA

Full Affymetrix probeset data:

Annotations for 1635216_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime