FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635217_at:

>probe:Drosophila_2:1635217_at:314:663; Interrogation_Position=178; Antisense; TAAATTTTTCCCACTTGCCTTATAT
>probe:Drosophila_2:1635217_at:510:391; Interrogation_Position=208; Antisense; GAAACCGCTAGATGATTTCCCAATC
>probe:Drosophila_2:1635217_at:188:197; Interrogation_Position=242; Antisense; AACGGCTATCCACTGCATTCGCTAG
>probe:Drosophila_2:1635217_at:474:15; Interrogation_Position=281; Antisense; ATTTTCCAGCCCAATGGAAGGCCGC
>probe:Drosophila_2:1635217_at:272:371; Interrogation_Position=297; Antisense; GAAGGCCGCGAAAAGCTCAACAGTC
>probe:Drosophila_2:1635217_at:218:649; Interrogation_Position=313; Antisense; TCAACAGTCGGAGCTTTTCCAGCAC
>probe:Drosophila_2:1635217_at:490:695; Interrogation_Position=328; Antisense; TTTCCAGCACTTCGGATTCACAGGA
>probe:Drosophila_2:1635217_at:152:533; Interrogation_Position=385; Antisense; GGTGGGCACCACAGTTCAGCTCGAG
>probe:Drosophila_2:1635217_at:278:215; Interrogation_Position=439; Antisense; AAGTTCGTGAGAGCGGCAGTCGCCA
>probe:Drosophila_2:1635217_at:13:359; Interrogation_Position=504; Antisense; GCAAACTGTTGCTCGTCGGTGTGTG
>probe:Drosophila_2:1635217_at:465:341; Interrogation_Position=533; Antisense; GCTATTTGTGGTGGTGTTTGTGCTA
>probe:Drosophila_2:1635217_at:453:441; Interrogation_Position=572; Antisense; GATGGTGTACCAGTATCGGTGTGCT
>probe:Drosophila_2:1635217_at:676:683; Interrogation_Position=585; Antisense; TATCGGTGTGCTGATGTTTGTCGCG
>probe:Drosophila_2:1635217_at:108:159; Interrogation_Position=72; Antisense; ACACTTGTAACTAGTCTTGCTCTTG

Paste this into a BLAST search page for me
TAAATTTTTCCCACTTGCCTTATATGAAACCGCTAGATGATTTCCCAATCAACGGCTATCCACTGCATTCGCTAGATTTTCCAGCCCAATGGAAGGCCGCGAAGGCCGCGAAAAGCTCAACAGTCTCAACAGTCGGAGCTTTTCCAGCACTTTCCAGCACTTCGGATTCACAGGAGGTGGGCACCACAGTTCAGCTCGAGAAGTTCGTGAGAGCGGCAGTCGCCAGCAAACTGTTGCTCGTCGGTGTGTGGCTATTTGTGGTGGTGTTTGTGCTAGATGGTGTACCAGTATCGGTGTGCTTATCGGTGTGCTGATGTTTGTCGCGACACTTGTAACTAGTCTTGCTCTTG

Full Affymetrix probeset data:

Annotations for 1635217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720