Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635218_at:

>probe:Drosophila_2:1635218_at:523:241; Interrogation_Position=1168; Antisense; AATAGCCAGATTCGGCAGCACCCAT
>probe:Drosophila_2:1635218_at:710:111; Interrogation_Position=1184; Antisense; AGCACCCATCATTATTTCTATCCAA
>probe:Drosophila_2:1635218_at:156:103; Interrogation_Position=1214; Antisense; AGACCCATGTGTGTTGTGCTGGTTC
>probe:Drosophila_2:1635218_at:459:333; Interrogation_Position=1231; Antisense; GCTGGTTCCAGCTTTGATACCGTAA
>probe:Drosophila_2:1635218_at:616:107; Interrogation_Position=1272; Antisense; AGAAGCCGAAGCTGCAGCAAGTGCT
>probe:Drosophila_2:1635218_at:265:111; Interrogation_Position=1287; Antisense; AGCAAGTGCTTACAACACACCCTAC
>probe:Drosophila_2:1635218_at:41:331; Interrogation_Position=1319; Antisense; GCGGGCCCAGTGGATCAGGCAACAA
>probe:Drosophila_2:1635218_at:505:563; Interrogation_Position=1336; Antisense; GGCAACAATGATTTACCACCTTCTT
>probe:Drosophila_2:1635218_at:459:149; Interrogation_Position=1367; Antisense; ACTTGCCACCCAGTTATGATGATGC
>probe:Drosophila_2:1635218_at:407:119; Interrogation_Position=1415; Antisense; AGCTGCATACTATATTCCCTTACGA
>probe:Drosophila_2:1635218_at:596:489; Interrogation_Position=1459; Antisense; GTAATTACTGCTCATTCCGTTGATG
>probe:Drosophila_2:1635218_at:430:15; Interrogation_Position=1498; Antisense; ATTATTGTTGTTTTCGGGCATTACA
>probe:Drosophila_2:1635218_at:105:273; Interrogation_Position=1592; Antisense; CATATGCTTTGATTTCTGGTCACAA
>probe:Drosophila_2:1635218_at:624:109; Interrogation_Position=1621; Antisense; AGAATTTTGCTCTTTCGGCTTGATA

Paste this into a BLAST search page for me
AATAGCCAGATTCGGCAGCACCCATAGCACCCATCATTATTTCTATCCAAAGACCCATGTGTGTTGTGCTGGTTCGCTGGTTCCAGCTTTGATACCGTAAAGAAGCCGAAGCTGCAGCAAGTGCTAGCAAGTGCTTACAACACACCCTACGCGGGCCCAGTGGATCAGGCAACAAGGCAACAATGATTTACCACCTTCTTACTTGCCACCCAGTTATGATGATGCAGCTGCATACTATATTCCCTTACGAGTAATTACTGCTCATTCCGTTGATGATTATTGTTGTTTTCGGGCATTACACATATGCTTTGATTTCTGGTCACAAAGAATTTTGCTCTTTCGGCTTGATA

Full Affymetrix probeset data:

Annotations for 1635218_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime