FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635219_at:

>probe:Drosophila_2:1635219_at:713:295; Interrogation_Position=116; Antisense; CGAACAGTGTGCACGAGACGCTGCT
>probe:Drosophila_2:1635219_at:671:69; Interrogation_Position=149; Antisense; AGGCCACCAGACTGCTGCGCAAGTT
>probe:Drosophila_2:1635219_at:326:439; Interrogation_Position=205; Antisense; GAGGCCGAGCAGTACTTGGACATCT
>probe:Drosophila_2:1635219_at:204:109; Interrogation_Position=233; Antisense; AGAAGTGCGCCGAGTTTCTCGCTGA
>probe:Drosophila_2:1635219_at:234:585; Interrogation_Position=287; Antisense; TGGACGAACTGGTCGATCTGGGCCT
>probe:Drosophila_2:1635219_at:203:361; Interrogation_Position=29; Antisense; GCAAGAACAAGACCCTACAGCTGAT
>probe:Drosophila_2:1635219_at:203:421; Interrogation_Position=325; Antisense; GAGCAGGATCTCTCCAGGCGCATGC
>probe:Drosophila_2:1635219_at:186:141; Interrogation_Position=364; Antisense; ACGGACATCAGCAGCGGGCTCTATC
>probe:Drosophila_2:1635219_at:223:45; Interrogation_Position=386; Antisense; ATCGCATCCAGAGCAAATGTCGCAA
>probe:Drosophila_2:1635219_at:132:461; Interrogation_Position=430; Antisense; GATTTTCGAGACTTCAGGGACGCCA
>probe:Drosophila_2:1635219_at:382:285; Interrogation_Position=458; Antisense; CTGATAAGATGCGTCGGGTGCCAAA
>probe:Drosophila_2:1635219_at:381:263; Interrogation_Position=46; Antisense; CAGCTGATAAGGTGCTTCTGCGGAT
>probe:Drosophila_2:1635219_at:450:445; Interrogation_Position=68; Antisense; GATGCAGTAACATGACTGTCGCCGA
>probe:Drosophila_2:1635219_at:590:329; Interrogation_Position=96; Antisense; GCGGAGGATCTATGTTCTGTCGAAC

Paste this into a BLAST search page for me
CGAACAGTGTGCACGAGACGCTGCTAGGCCACCAGACTGCTGCGCAAGTTGAGGCCGAGCAGTACTTGGACATCTAGAAGTGCGCCGAGTTTCTCGCTGATGGACGAACTGGTCGATCTGGGCCTGCAAGAACAAGACCCTACAGCTGATGAGCAGGATCTCTCCAGGCGCATGCACGGACATCAGCAGCGGGCTCTATCATCGCATCCAGAGCAAATGTCGCAAGATTTTCGAGACTTCAGGGACGCCACTGATAAGATGCGTCGGGTGCCAAACAGCTGATAAGGTGCTTCTGCGGATGATGCAGTAACATGACTGTCGCCGAGCGGAGGATCTATGTTCTGTCGAAC

Full Affymetrix probeset data:

Annotations for 1635219_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720