FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635220_at:

>probe:Drosophila_2:1635220_at:417:373; Interrogation_Position=1003; Antisense; GAAGTCACCTTTCTTATGTGCCTGG
>probe:Drosophila_2:1635220_at:133:13; Interrogation_Position=1065; Antisense; ATTCATGCGAATGGTCTCCTTGGGC
>probe:Drosophila_2:1635220_at:96:91; Interrogation_Position=1091; Antisense; AGTACCTGCTCTTAGTTCTCTACGA
>probe:Drosophila_2:1635220_at:539:713; Interrogation_Position=1106; Antisense; TTCTCTACGAGCTGTTCATCATCTG
>probe:Drosophila_2:1635220_at:429:665; Interrogation_Position=1132; Antisense; TACTTCGCGGACATCGTTTTTCAGA
>probe:Drosophila_2:1635220_at:659:477; Interrogation_Position=1147; Antisense; GTTTTTCAGAACAGCCAGCGGTGCG
>probe:Drosophila_2:1635220_at:550:581; Interrogation_Position=1183; Antisense; TGGCGAAGTCCTTGGCAGCGACATT
>probe:Drosophila_2:1635220_at:606:471; Interrogation_Position=1233; Antisense; GTTCTTTATGCTGAATTCCCGCAGG
>probe:Drosophila_2:1635220_at:221:435; Interrogation_Position=1310; Antisense; GAGGGACTATTACTACTGCCTTCTC
>probe:Drosophila_2:1635220_at:131:639; Interrogation_Position=1333; Antisense; TCGTTTCTCACCTTGCTGCAAAAGA
>probe:Drosophila_2:1635220_at:24:73; Interrogation_Position=813; Antisense; AGGTCAGTATGCTTACTCCGTGGAG
>probe:Drosophila_2:1635220_at:21:649; Interrogation_Position=899; Antisense; TCAGGCTGTCTTTTGTGCGGTGCAT
>probe:Drosophila_2:1635220_at:253:345; Interrogation_Position=920; Antisense; GCATTCAGCACCATCGATACATAGT
>probe:Drosophila_2:1635220_at:720:425; Interrogation_Position=964; Antisense; GAGAGTTTCTACAGTCCCATATGGT

Paste this into a BLAST search page for me
GAAGTCACCTTTCTTATGTGCCTGGATTCATGCGAATGGTCTCCTTGGGCAGTACCTGCTCTTAGTTCTCTACGATTCTCTACGAGCTGTTCATCATCTGTACTTCGCGGACATCGTTTTTCAGAGTTTTTCAGAACAGCCAGCGGTGCGTGGCGAAGTCCTTGGCAGCGACATTGTTCTTTATGCTGAATTCCCGCAGGGAGGGACTATTACTACTGCCTTCTCTCGTTTCTCACCTTGCTGCAAAAGAAGGTCAGTATGCTTACTCCGTGGAGTCAGGCTGTCTTTTGTGCGGTGCATGCATTCAGCACCATCGATACATAGTGAGAGTTTCTACAGTCCCATATGGT

Full Affymetrix probeset data:

Annotations for 1635220_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720