FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635221_at:

>probe:Drosophila_2:1635221_at:150:173; Interrogation_Position=108; Antisense; AAAGATCCGTGATCGCTCACATTTC
>probe:Drosophila_2:1635221_at:272:69; Interrogation_Position=148; Antisense; AGGCTTCGTGGTCGTCACCCATTTG
>probe:Drosophila_2:1635221_at:53:631; Interrogation_Position=180; Antisense; TCCATTTCACTTTCAGCCTTATGAA
>probe:Drosophila_2:1635221_at:496:53; Interrogation_Position=200; Antisense; ATGAAGTTATTACGCGACTCCGTTC
>probe:Drosophila_2:1635221_at:180:613; Interrogation_Position=228; Antisense; TGAACTCAGCATGGACCTCATTGTG
>probe:Drosophila_2:1635221_at:165:5; Interrogation_Position=247; Antisense; ATTGTGCCACCGAACGGACTCTATG
>probe:Drosophila_2:1635221_at:279:557; Interrogation_Position=262; Antisense; GGACTCTATGAGATGCCACACCAAC
>probe:Drosophila_2:1635221_at:564:261; Interrogation_Position=280; Antisense; CACCAACCAGAGTATCCGGATTATG
>probe:Drosophila_2:1635221_at:308:375; Interrogation_Position=314; Antisense; GAAGACCGGTAGAGTCGTTGCGCAT
>probe:Drosophila_2:1635221_at:70:497; Interrogation_Position=32; Antisense; GTCAGAGTGATACCGACTCCGATCT
>probe:Drosophila_2:1635221_at:712:561; Interrogation_Position=369; Antisense; GGAACTCGAGTTTTTCTTCAATACG
>probe:Drosophila_2:1635221_at:559:493; Interrogation_Position=409; Antisense; GTCAATTCCGAGGTGTTTCGAGGTG
>probe:Drosophila_2:1635221_at:330:257; Interrogation_Position=445; Antisense; CACAGCACAGAATTTGGGACTCGTT
>probe:Drosophila_2:1635221_at:708:245; Interrogation_Position=88; Antisense; AATTCCACCGATGCCCAGATAAAGA

Paste this into a BLAST search page for me
AAAGATCCGTGATCGCTCACATTTCAGGCTTCGTGGTCGTCACCCATTTGTCCATTTCACTTTCAGCCTTATGAAATGAAGTTATTACGCGACTCCGTTCTGAACTCAGCATGGACCTCATTGTGATTGTGCCACCGAACGGACTCTATGGGACTCTATGAGATGCCACACCAACCACCAACCAGAGTATCCGGATTATGGAAGACCGGTAGAGTCGTTGCGCATGTCAGAGTGATACCGACTCCGATCTGGAACTCGAGTTTTTCTTCAATACGGTCAATTCCGAGGTGTTTCGAGGTGCACAGCACAGAATTTGGGACTCGTTAATTCCACCGATGCCCAGATAAAGA

Full Affymetrix probeset data:

Annotations for 1635221_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720