FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635222_at:

>probe:Drosophila_2:1635222_at:153:77; Interrogation_Position=2054; Antisense; AGGAGTACATAGTGACCTTCCCCAA
>probe:Drosophila_2:1635222_at:475:195; Interrogation_Position=2077; Antisense; AACGGCTACGGCAGGTCTATTCTTA
>probe:Drosophila_2:1635222_at:297:645; Interrogation_Position=2097; Antisense; TCTTACGGTGCCTTGGATTGAGCTC
>probe:Drosophila_2:1635222_at:407:551; Interrogation_Position=2133; Antisense; GGAGATCAAGTGTCCACAGTCTGGA
>probe:Drosophila_2:1635222_at:618:357; Interrogation_Position=2201; Antisense; GCAAACGGAACAGGGTCTCGGCAGA
>probe:Drosophila_2:1635222_at:487:351; Interrogation_Position=2221; Antisense; GCAGAGGTCTATGCGCCGAGCGAAA
>probe:Drosophila_2:1635222_at:341:211; Interrogation_Position=2245; Antisense; AAGAAGCCTTTCGTCTCTATTACGG
>probe:Drosophila_2:1635222_at:537:501; Interrogation_Position=2329; Antisense; GTCGACGTAAATCGCATACCCATAT
>probe:Drosophila_2:1635222_at:620:443; Interrogation_Position=2386; Antisense; GATGAGTACGAATCGCGACGCGTTT
>probe:Drosophila_2:1635222_at:622:85; Interrogation_Position=2418; Antisense; AGTGACAGCGGGACTCAAGTTCAAT
>probe:Drosophila_2:1635222_at:82:93; Interrogation_Position=2435; Antisense; AGTTCAATGACATCGAGCGCGCTAC
>probe:Drosophila_2:1635222_at:28:123; Interrogation_Position=2450; Antisense; AGCGCGCTACAACTGCCAAATTCGT
>probe:Drosophila_2:1635222_at:291:581; Interrogation_Position=2525; Antisense; TGGCCTGGGAGCACAAGCACTTTAA
>probe:Drosophila_2:1635222_at:445:205; Interrogation_Position=2548; Antisense; AAGCCCGTGGGCGACAACTGGATCT

Paste this into a BLAST search page for me
AGGAGTACATAGTGACCTTCCCCAAAACGGCTACGGCAGGTCTATTCTTATCTTACGGTGCCTTGGATTGAGCTCGGAGATCAAGTGTCCACAGTCTGGAGCAAACGGAACAGGGTCTCGGCAGAGCAGAGGTCTATGCGCCGAGCGAAAAAGAAGCCTTTCGTCTCTATTACGGGTCGACGTAAATCGCATACCCATATGATGAGTACGAATCGCGACGCGTTTAGTGACAGCGGGACTCAAGTTCAATAGTTCAATGACATCGAGCGCGCTACAGCGCGCTACAACTGCCAAATTCGTTGGCCTGGGAGCACAAGCACTTTAAAAGCCCGTGGGCGACAACTGGATCT

Full Affymetrix probeset data:

Annotations for 1635222_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720