FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635223_at:

>probe:Drosophila_2:1635223_at:321:169; Interrogation_Position=107; Antisense; AAATGGTCCCCATGAGTTCGGCACA
>probe:Drosophila_2:1635223_at:338:567; Interrogation_Position=126; Antisense; GGCACACCTGGAAACGGCATTTACA
>probe:Drosophila_2:1635223_at:561:369; Interrogation_Position=165; Antisense; GAAGGACCCTACACAGTGCCCGAAA
>probe:Drosophila_2:1635223_at:348:181; Interrogation_Position=205; Antisense; AAAACTCACCCTCAAGTGGGCAGCA
>probe:Drosophila_2:1635223_at:128:595; Interrogation_Position=221; Antisense; TGGGCAGCATTCCTACACCGATGAG
>probe:Drosophila_2:1635223_at:477:419; Interrogation_Position=243; Antisense; GAGCACGGAAATACTTACACCCATT
>probe:Drosophila_2:1635223_at:118:719; Interrogation_Position=266; Antisense; TTCCTCAACGGCAACTGTCACAAGT
>probe:Drosophila_2:1635223_at:115:161; Interrogation_Position=285; Antisense; ACAAGTTTGGCCTATTCAACCTTCG
>probe:Drosophila_2:1635223_at:84:575; Interrogation_Position=321; Antisense; GGCGGCGTTCTCATTTTTCTAATTA
>probe:Drosophila_2:1635223_at:603:187; Interrogation_Position=404; Antisense; AACACATCGTTTTTCAGTTCACGCC
>probe:Drosophila_2:1635223_at:35:363; Interrogation_Position=462; Antisense; GAATAACCATTTTCCTTCTAAGTAT
>probe:Drosophila_2:1635223_at:541:9; Interrogation_Position=502; Antisense; ATTCGCTATTTCTTTTGTTCACCTT
>probe:Drosophila_2:1635223_at:641:23; Interrogation_Position=51; Antisense; ATAGTGAGCACGCTGTTGTTTGCCG
>probe:Drosophila_2:1635223_at:138:481; Interrogation_Position=68; Antisense; GTTTGCCGTGACAAATGCGCAGCAG

Paste this into a BLAST search page for me
AAATGGTCCCCATGAGTTCGGCACAGGCACACCTGGAAACGGCATTTACAGAAGGACCCTACACAGTGCCCGAAAAAAACTCACCCTCAAGTGGGCAGCATGGGCAGCATTCCTACACCGATGAGGAGCACGGAAATACTTACACCCATTTTCCTCAACGGCAACTGTCACAAGTACAAGTTTGGCCTATTCAACCTTCGGGCGGCGTTCTCATTTTTCTAATTAAACACATCGTTTTTCAGTTCACGCCGAATAACCATTTTCCTTCTAAGTATATTCGCTATTTCTTTTGTTCACCTTATAGTGAGCACGCTGTTGTTTGCCGGTTTGCCGTGACAAATGCGCAGCAG

Full Affymetrix probeset data:

Annotations for 1635223_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720