Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635225_at:

>probe:Drosophila_2:1635225_at:339:179; Interrogation_Position=2228; Antisense; AAACTTCAATCACATGCACGGCGAC
>probe:Drosophila_2:1635225_at:707:617; Interrogation_Position=2266; Antisense; TGCAGGTCTACAATCAGTGGGCGGA
>probe:Drosophila_2:1635225_at:143:425; Interrogation_Position=2289; Antisense; GAGACGGACTACAGCACCCAGTGGT
>probe:Drosophila_2:1635225_at:641:671; Interrogation_Position=2316; Antisense; TACGAGAACTTCATCCAGTACAGAT
>probe:Drosophila_2:1635225_at:455:427; Interrogation_Position=2397; Antisense; GAGATCGACATGGTCAGCTGCCTGC
>probe:Drosophila_2:1635225_at:64:89; Interrogation_Position=2429; Antisense; AGTAAACGTGCGCAAGGCAGCCACC
>probe:Drosophila_2:1635225_at:266:541; Interrogation_Position=2457; Antisense; GGTTACTTTTACCATGTGGCGCGAC
>probe:Drosophila_2:1635225_at:473:323; Interrogation_Position=2477; Antisense; GCGACTCTCGAAGGGCGGTCACTAC
>probe:Drosophila_2:1635225_at:372:103; Interrogation_Position=2503; Antisense; AGACCATCAAGCACAATCAGACCGT
>probe:Drosophila_2:1635225_at:59:513; Interrogation_Position=2526; Antisense; GTGATGATACATCCGAACTCCTCGC
>probe:Drosophila_2:1635225_at:666:333; Interrogation_Position=2588; Antisense; GCTGGTGTTCACCTCCAAGGAGTAC
>probe:Drosophila_2:1635225_at:164:251; Interrogation_Position=2603; Antisense; CAAGGAGTACATGCGTCAGGTTATA
>probe:Drosophila_2:1635225_at:410:433; Interrogation_Position=2652; Antisense; GAGGTGGCTCCGCACTACTACAAGG
>probe:Drosophila_2:1635225_at:474:373; Interrogation_Position=2705; Antisense; GAAGATGCCAAAAGTCGCCGGGCGA

Paste this into a BLAST search page for me
AAACTTCAATCACATGCACGGCGACTGCAGGTCTACAATCAGTGGGCGGAGAGACGGACTACAGCACCCAGTGGTTACGAGAACTTCATCCAGTACAGATGAGATCGACATGGTCAGCTGCCTGCAGTAAACGTGCGCAAGGCAGCCACCGGTTACTTTTACCATGTGGCGCGACGCGACTCTCGAAGGGCGGTCACTACAGACCATCAAGCACAATCAGACCGTGTGATGATACATCCGAACTCCTCGCGCTGGTGTTCACCTCCAAGGAGTACCAAGGAGTACATGCGTCAGGTTATAGAGGTGGCTCCGCACTACTACAAGGGAAGATGCCAAAAGTCGCCGGGCGA

Full Affymetrix probeset data:

Annotations for 1635225_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime