FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635226_at:

>probe:Drosophila_2:1635226_at:37:507; Interrogation_Position=1268; Antisense; GTGCCATATGCACTTTCACAGCATG
>probe:Drosophila_2:1635226_at:283:515; Interrogation_Position=1296; Antisense; GTGTTTGCCACCTTTGATATCTTCA
>probe:Drosophila_2:1635226_at:360:583; Interrogation_Position=1339; Antisense; TGGCTCAGGGACACAAGGCATCTTT
>probe:Drosophila_2:1635226_at:676:225; Interrogation_Position=1353; Antisense; AAGGCATCTTTCTGTTTGGAGGACA
>probe:Drosophila_2:1635226_at:370:73; Interrogation_Position=1372; Antisense; AGGACAGTAACTGCCTGCCGGGTGT
>probe:Drosophila_2:1635226_at:257:317; Interrogation_Position=1384; Antisense; GCCTGCCGGGTGTTGCCAAGAAGTA
>probe:Drosophila_2:1635226_at:673:109; Interrogation_Position=1402; Antisense; AGAAGTACAATTGCGCCAACTATGG
>probe:Drosophila_2:1635226_at:131:525; Interrogation_Position=1433; Antisense; GGGCATTTCCATTAACTGCTCGGAT
>probe:Drosophila_2:1635226_at:68:145; Interrogation_Position=1447; Antisense; ACTGCTCGGATGTGTACCTGTACAA
>probe:Drosophila_2:1635226_at:552:441; Interrogation_Position=1491; Antisense; GATGTGACAGACCTGATTCCCGGCA
>probe:Drosophila_2:1635226_at:192:337; Interrogation_Position=1581; Antisense; GCTGCCATCTGCGATCTGATATACA
>probe:Drosophila_2:1635226_at:144:525; Interrogation_Position=1731; Antisense; GGGCTTGTATATTTTCTACACCTAT
>probe:Drosophila_2:1635226_at:565:59; Interrogation_Position=1754; Antisense; ATGTATGTCTTTAACCCTAACTCGC
>probe:Drosophila_2:1635226_at:127:231; Interrogation_Position=1793; Antisense; AATGTGCACATCTGAAAACTCTTGA

Paste this into a BLAST search page for me
GTGCCATATGCACTTTCACAGCATGGTGTTTGCCACCTTTGATATCTTCATGGCTCAGGGACACAAGGCATCTTTAAGGCATCTTTCTGTTTGGAGGACAAGGACAGTAACTGCCTGCCGGGTGTGCCTGCCGGGTGTTGCCAAGAAGTAAGAAGTACAATTGCGCCAACTATGGGGGCATTTCCATTAACTGCTCGGATACTGCTCGGATGTGTACCTGTACAAGATGTGACAGACCTGATTCCCGGCAGCTGCCATCTGCGATCTGATATACAGGGCTTGTATATTTTCTACACCTATATGTATGTCTTTAACCCTAACTCGCAATGTGCACATCTGAAAACTCTTGA

Full Affymetrix probeset data:

Annotations for 1635226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720