FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635229_at:

>probe:Drosophila_2:1635229_at:619:687; Interrogation_Position=112; Antisense; TATATCTGCCTGGAACTCTATGCGG
>probe:Drosophila_2:1635229_at:683:51; Interrogation_Position=131; Antisense; ATGCGGCAACCAGGGATCTTGACTA
>probe:Drosophila_2:1635229_at:85:245; Interrogation_Position=157; Antisense; AATTTCGGATGTCAGCCATGTCGGG
>probe:Drosophila_2:1635229_at:81:291; Interrogation_Position=178; Antisense; CGGGTTAGCTTTGATCCACACGAAA
>probe:Drosophila_2:1635229_at:180:185; Interrogation_Position=241; Antisense; AAAATCCTGGAATTCGCCGACACGG
>probe:Drosophila_2:1635229_at:616:181; Interrogation_Position=284; Antisense; AAAAGTGGTCCCAGCTGAGCTTCCT
>probe:Drosophila_2:1635229_at:599:419; Interrogation_Position=300; Antisense; GAGCTTCCTTCATGTGTATCATCAT
>probe:Drosophila_2:1635229_at:300:27; Interrogation_Position=323; Antisense; ATAGCACCATGTTCGTCTTTTGTTG
>probe:Drosophila_2:1635229_at:274:221; Interrogation_Position=358; Antisense; AAGTGGATGCCAACGGGTTCGACCT
>probe:Drosophila_2:1635229_at:147:721; Interrogation_Position=531; Antisense; TTGGGCGTCACAGATGTTAGTCCGT
>probe:Drosophila_2:1635229_at:202:545; Interrogation_Position=575; Antisense; GGATAACCCTATCGATGGCCATATA
>probe:Drosophila_2:1635229_at:204:627; Interrogation_Position=605; Antisense; TGCCTTTCCTCTTTATGTTCGGGAA
>probe:Drosophila_2:1635229_at:730:89; Interrogation_Position=644; Antisense; AGTACACGGTATCAGCAGTCGGCAA
>probe:Drosophila_2:1635229_at:722:153; Interrogation_Position=83; Antisense; ACAGCTTGGCCATGGTGTTCCTAAA

Paste this into a BLAST search page for me
TATATCTGCCTGGAACTCTATGCGGATGCGGCAACCAGGGATCTTGACTAAATTTCGGATGTCAGCCATGTCGGGCGGGTTAGCTTTGATCCACACGAAAAAAATCCTGGAATTCGCCGACACGGAAAAGTGGTCCCAGCTGAGCTTCCTGAGCTTCCTTCATGTGTATCATCATATAGCACCATGTTCGTCTTTTGTTGAAGTGGATGCCAACGGGTTCGACCTTTGGGCGTCACAGATGTTAGTCCGTGGATAACCCTATCGATGGCCATATATGCCTTTCCTCTTTATGTTCGGGAAAGTACACGGTATCAGCAGTCGGCAAACAGCTTGGCCATGGTGTTCCTAAA

Full Affymetrix probeset data:

Annotations for 1635229_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720