Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635230_at:

>probe:Drosophila_2:1635230_at:308:443; Interrogation_Position=162; Antisense; GATGTCCGGATTTGAAGAGCCTAAA
>probe:Drosophila_2:1635230_at:61:427; Interrogation_Position=209; Antisense; GAGAGTCTAGCATATCAACACCATT
>probe:Drosophila_2:1635230_at:355:153; Interrogation_Position=226; Antisense; ACACCATTCAGTTGCTATAGGGAGG
>probe:Drosophila_2:1635230_at:627:153; Interrogation_Position=258; Antisense; AAGGTCCTCGTCCAGAGTTAAGTCT
>probe:Drosophila_2:1635230_at:673:497; Interrogation_Position=279; Antisense; GTCTACCGGAAAGTACAGTTGCAAC
>probe:Drosophila_2:1635230_at:413:467; Interrogation_Position=296; Antisense; GTTGCAACTGCTTCACAAAGGAACA
>probe:Drosophila_2:1635230_at:116:459; Interrogation_Position=427; Antisense; GATTTTACTTTTTGCAAGCCACCGC
>probe:Drosophila_2:1635230_at:128:133; Interrogation_Position=447; Antisense; ACCGCAGAGTGGACGATTGTCATCT
>probe:Drosophila_2:1635230_at:104:293; Interrogation_Position=553; Antisense; CGTACTACTGCCACCAATGATTTGT
>probe:Drosophila_2:1635230_at:453:57; Interrogation_Position=569; Antisense; ATGATTTGTCTAATTCCGAGGTAAT
>probe:Drosophila_2:1635230_at:677:687; Interrogation_Position=595; Antisense; TATTCGACGATAAAGCGCTTGCTGC
>probe:Drosophila_2:1635230_at:7:345; Interrogation_Position=611; Antisense; GCTTGCTGCGCGTATGTCTGAACAA
>probe:Drosophila_2:1635230_at:623:95; Interrogation_Position=638; Antisense; AGATAATCGAACTTGGGCTCCTGGA
>probe:Drosophila_2:1635230_at:519:571; Interrogation_Position=653; Antisense; GGCTCCTGGATAGTCTGCATGATGC

Paste this into a BLAST search page for me
GATGTCCGGATTTGAAGAGCCTAAAGAGAGTCTAGCATATCAACACCATTACACCATTCAGTTGCTATAGGGAGGAAGGTCCTCGTCCAGAGTTAAGTCTGTCTACCGGAAAGTACAGTTGCAACGTTGCAACTGCTTCACAAAGGAACAGATTTTACTTTTTGCAAGCCACCGCACCGCAGAGTGGACGATTGTCATCTCGTACTACTGCCACCAATGATTTGTATGATTTGTCTAATTCCGAGGTAATTATTCGACGATAAAGCGCTTGCTGCGCTTGCTGCGCGTATGTCTGAACAAAGATAATCGAACTTGGGCTCCTGGAGGCTCCTGGATAGTCTGCATGATGC

Full Affymetrix probeset data:

Annotations for 1635230_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime