Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635232_at:

>probe:Drosophila_2:1635232_at:251:719; Interrogation_Position=345; Antisense; TTCCCGGCATGGACTGGAACACTGT
>probe:Drosophila_2:1635232_at:692:17; Interrogation_Position=488; Antisense; ATTTCCGATTTGCTGCAGGGCCTCA
>probe:Drosophila_2:1635232_at:187:201; Interrogation_Position=512; Antisense; AACCTGGACGACCTGGCCGATGGAA
>probe:Drosophila_2:1635232_at:660:373; Interrogation_Position=534; Antisense; GAAGTCTCTTCGAGGATGATTCCGA
>probe:Drosophila_2:1635232_at:378:9; Interrogation_Position=552; Antisense; ATTCCGAGGTGGTCAACGCGGCCGA
>probe:Drosophila_2:1635232_at:57:585; Interrogation_Position=580; Antisense; TGGAAATGCGGAGATTCCCCTGGCC
>probe:Drosophila_2:1635232_at:161:579; Interrogation_Position=601; Antisense; GGCCGATGGACCAATCAGCCAGGCT
>probe:Drosophila_2:1635232_at:59:651; Interrogation_Position=615; Antisense; TCAGCCAGGCTGACGATGATCGCGA
>probe:Drosophila_2:1635232_at:532:295; Interrogation_Position=661; Antisense; CGAGATCGATGCCATGGATCGCCAG
>probe:Drosophila_2:1635232_at:48:543; Interrogation_Position=695; Antisense; GGATTGAGTCCCAAGCATCTGGTCT
>probe:Drosophila_2:1635232_at:391:41; Interrogation_Position=711; Antisense; ATCTGGTCTCCATACTGATGCAGGA
>probe:Drosophila_2:1635232_at:639:407; Interrogation_Position=741; Antisense; GACGTCGCCGCATCCAGGAGGTTCT
>probe:Drosophila_2:1635232_at:466:77; Interrogation_Position=756; Antisense; AGGAGGTTCTCGCTGGCATCTATCT
>probe:Drosophila_2:1635232_at:420:333; Interrogation_Position=767; Antisense; GCTGGCATCTATCTGAGGAACTACA

Paste this into a BLAST search page for me
TTCCCGGCATGGACTGGAACACTGTATTTCCGATTTGCTGCAGGGCCTCAAACCTGGACGACCTGGCCGATGGAAGAAGTCTCTTCGAGGATGATTCCGAATTCCGAGGTGGTCAACGCGGCCGATGGAAATGCGGAGATTCCCCTGGCCGGCCGATGGACCAATCAGCCAGGCTTCAGCCAGGCTGACGATGATCGCGACGAGATCGATGCCATGGATCGCCAGGGATTGAGTCCCAAGCATCTGGTCTATCTGGTCTCCATACTGATGCAGGAGACGTCGCCGCATCCAGGAGGTTCTAGGAGGTTCTCGCTGGCATCTATCTGCTGGCATCTATCTGAGGAACTACA

Full Affymetrix probeset data:

Annotations for 1635232_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime