FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635233_at:

>probe:Drosophila_2:1635233_at:283:35; Interrogation_Position=103; Antisense; ATCAGTTTCAACTTTTGGCAGGAGT
>probe:Drosophila_2:1635233_at:544:547; Interrogation_Position=123; Antisense; GGAGTTCGAACACATCCGGTCGATC
>probe:Drosophila_2:1635233_at:612:43; Interrogation_Position=155; Antisense; ATCGCATAACGCAGGAGCGCTTGCA
>probe:Drosophila_2:1635233_at:613:617; Interrogation_Position=176; Antisense; TGCAGCGAGAGCGAATTACCACTTT
>probe:Drosophila_2:1635233_at:558:11; Interrogation_Position=190; Antisense; ATTACCACTTTGATCCGGGATGGAC
>probe:Drosophila_2:1635233_at:674:69; Interrogation_Position=239; Antisense; AGGCCCTAAGCCGTTCGATCAGTGC
>probe:Drosophila_2:1635233_at:621:707; Interrogation_Position=286; Antisense; TTACCATCACCATTGTCAGCAGTCC
>probe:Drosophila_2:1635233_at:93:503; Interrogation_Position=307; Antisense; GTCCCAACTGCGTCCATGGTGAAGA
>probe:Drosophila_2:1635233_at:417:235; Interrogation_Position=364; Antisense; AATCGCACAAGTCCGGGTGTCAAAC
>probe:Drosophila_2:1635233_at:299:209; Interrogation_Position=400; Antisense; AAGCAGAAGTTCCAATCACCCAAGC
>probe:Drosophila_2:1635233_at:711:371; Interrogation_Position=454; Antisense; GAAGGTGAACCGAACTTGCCATCTC
>probe:Drosophila_2:1635233_at:509:213; Interrogation_Position=516; Antisense; AAGAGCCACAATGATCACCCCGAAT
>probe:Drosophila_2:1635233_at:258:363; Interrogation_Position=537; Antisense; GAATATCTCCAACGGTGTAACTCCC
>probe:Drosophila_2:1635233_at:103:355; Interrogation_Position=89; Antisense; GCAACTCGGCGGAAATCAGTTTCAA

Paste this into a BLAST search page for me
ATCAGTTTCAACTTTTGGCAGGAGTGGAGTTCGAACACATCCGGTCGATCATCGCATAACGCAGGAGCGCTTGCATGCAGCGAGAGCGAATTACCACTTTATTACCACTTTGATCCGGGATGGACAGGCCCTAAGCCGTTCGATCAGTGCTTACCATCACCATTGTCAGCAGTCCGTCCCAACTGCGTCCATGGTGAAGAAATCGCACAAGTCCGGGTGTCAAACAAGCAGAAGTTCCAATCACCCAAGCGAAGGTGAACCGAACTTGCCATCTCAAGAGCCACAATGATCACCCCGAATGAATATCTCCAACGGTGTAACTCCCGCAACTCGGCGGAAATCAGTTTCAA

Full Affymetrix probeset data:

Annotations for 1635233_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720