FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635234_at:

>probe:Drosophila_2:1635234_at:121:197; Interrogation_Position=2137; Antisense; AACGGTGAGGCATCTAGCCAGCGCT
>probe:Drosophila_2:1635234_at:408:549; Interrogation_Position=2220; Antisense; GGAGGATATTGAGCCACCACAGCCG
>probe:Drosophila_2:1635234_at:50:333; Interrogation_Position=2248; Antisense; GCTGGCGATTTGACGCGTCGCGAAA
>probe:Drosophila_2:1635234_at:575:141; Interrogation_Position=2356; Antisense; ACGGAGCCGGCCATCATTAGCGATG
>probe:Drosophila_2:1635234_at:223:301; Interrogation_Position=2381; Antisense; CCCGCCTGGGCGAGTTCAAGAACAA
>probe:Drosophila_2:1635234_at:15:21; Interrogation_Position=2405; Antisense; ATTTGCAGCGACTGTTTCGCGAGGC
>probe:Drosophila_2:1635234_at:299:197; Interrogation_Position=2473; Antisense; AACGTTGGCAGCCAGGAGCCGTTCA
>probe:Drosophila_2:1635234_at:634:291; Interrogation_Position=2520; Antisense; CGTGCATCGCATGACCGAGGACAAT
>probe:Drosophila_2:1635234_at:131:239; Interrogation_Position=2541; Antisense; CAATCAGATCATGGTCGCCGACGAT
>probe:Drosophila_2:1635234_at:329:459; Interrogation_Position=2563; Antisense; GATATAGTCTTTCTCATCTGATCGC
>probe:Drosophila_2:1635234_at:166:41; Interrogation_Position=2578; Antisense; ATCTGATCGCGCATTCCAAGGAGCA
>probe:Drosophila_2:1635234_at:156:725; Interrogation_Position=2619; Antisense; TTGCATCCATCAATCCATCCTTTAT
>probe:Drosophila_2:1635234_at:136:49; Interrogation_Position=2635; Antisense; ATCCTTTATCCATCAACCATTCTAG
>probe:Drosophila_2:1635234_at:675:129; Interrogation_Position=2650; Antisense; ACCATTCTAGCGCTTAAGTTGTCAT

Paste this into a BLAST search page for me
AACGGTGAGGCATCTAGCCAGCGCTGGAGGATATTGAGCCACCACAGCCGGCTGGCGATTTGACGCGTCGCGAAAACGGAGCCGGCCATCATTAGCGATGCCCGCCTGGGCGAGTTCAAGAACAAATTTGCAGCGACTGTTTCGCGAGGCAACGTTGGCAGCCAGGAGCCGTTCACGTGCATCGCATGACCGAGGACAATCAATCAGATCATGGTCGCCGACGATGATATAGTCTTTCTCATCTGATCGCATCTGATCGCGCATTCCAAGGAGCATTGCATCCATCAATCCATCCTTTATATCCTTTATCCATCAACCATTCTAGACCATTCTAGCGCTTAAGTTGTCAT

Full Affymetrix probeset data:

Annotations for 1635234_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720