FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635235_at:

>probe:Drosophila_2:1635235_at:463:249; Interrogation_Position=139; Antisense; GTCGTCATCGTTGAAAGCCGGCCTC
>probe:Drosophila_2:1635235_at:164:591; Interrogation_Position=186; Antisense; TGTCTTGACCAAGATCCAGGCGACC
>probe:Drosophila_2:1635235_at:292:713; Interrogation_Position=236; Antisense; TTCTCGCTCTCTTTGGGTTGTATGA
>probe:Drosophila_2:1635235_at:428:105; Interrogation_Position=263; Antisense; AGACATCTCATTGGGCGATCACTGC
>probe:Drosophila_2:1635235_at:334:157; Interrogation_Position=299; Antisense; ACACACGAGCACTTCCAAACAGGGA
>probe:Drosophila_2:1635235_at:291:23; Interrogation_Position=30; Antisense; ATATACAGCCATATCTAGTGGGCAG
>probe:Drosophila_2:1635235_at:452:189; Interrogation_Position=316; Antisense; AACAGGGACATGCAGAGCCCGGCTT
>probe:Drosophila_2:1635235_at:218:125; Interrogation_Position=331; Antisense; AGCCCGGCTTTGGATGTTGGCCAGA
>probe:Drosophila_2:1635235_at:249:609; Interrogation_Position=375; Antisense; TGAACGAAAGCCACCTTACCTGTTT
>probe:Drosophila_2:1635235_at:333:263; Interrogation_Position=443; Antisense; CAGAAAGGTGCACGCGCGCATTCAA
>probe:Drosophila_2:1635235_at:166:649; Interrogation_Position=464; Antisense; TCAACACGGTTGTGTGGCCCTCGAT
>probe:Drosophila_2:1635235_at:714:281; Interrogation_Position=483; Antisense; CTCGATCCGAGGTTCTTGTGTGATT
>probe:Drosophila_2:1635235_at:609:557; Interrogation_Position=532; Antisense; GGAACGGATTTGCTTGAGCCCCAGA
>probe:Drosophila_2:1635235_at:306:425; Interrogation_Position=555; Antisense; GAGACCCAGAGGTGCTGAGCCATAA

Paste this into a BLAST search page for me
GTCGTCATCGTTGAAAGCCGGCCTCTGTCTTGACCAAGATCCAGGCGACCTTCTCGCTCTCTTTGGGTTGTATGAAGACATCTCATTGGGCGATCACTGCACACACGAGCACTTCCAAACAGGGAATATACAGCCATATCTAGTGGGCAGAACAGGGACATGCAGAGCCCGGCTTAGCCCGGCTTTGGATGTTGGCCAGATGAACGAAAGCCACCTTACCTGTTTCAGAAAGGTGCACGCGCGCATTCAATCAACACGGTTGTGTGGCCCTCGATCTCGATCCGAGGTTCTTGTGTGATTGGAACGGATTTGCTTGAGCCCCAGAGAGACCCAGAGGTGCTGAGCCATAA

Full Affymetrix probeset data:

Annotations for 1635235_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720