FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635236_at:

>probe:Drosophila_2:1635236_at:149:57; Interrogation_Position=13; Antisense; ATGACTGATCTGTCGCCGACCACCT
>probe:Drosophila_2:1635236_at:11:611; Interrogation_Position=212; Antisense; TGACCAAGATCCACCGCCAGAGCAG
>probe:Drosophila_2:1635236_at:451:413; Interrogation_Position=30; Antisense; GACCACCTCTGGGTTTCTACATGGC
>probe:Drosophila_2:1635236_at:626:337; Interrogation_Position=306; Antisense; GCTCTTCTCCTACTTCGGAAACGAG
>probe:Drosophila_2:1635236_at:42:665; Interrogation_Position=316; Antisense; TACTTCGGAAACGAGCAGGATCACG
>probe:Drosophila_2:1635236_at:144:115; Interrogation_Position=329; Antisense; AGCAGGATCACGAGCGCAAGAAGTC
>probe:Drosophila_2:1635236_at:443:647; Interrogation_Position=336; Antisense; TCACGAGCGCAAGAAGTCGGAGACT
>probe:Drosophila_2:1635236_at:203:87; Interrogation_Position=350; Antisense; AGTCGGAGACTTCGTTCTTTAATCT
>probe:Drosophila_2:1635236_at:647:401; Interrogation_Position=357; Antisense; GACTTCGTTCTTTAATCTCGGATTT
>probe:Drosophila_2:1635236_at:596:627; Interrogation_Position=372; Antisense; TCTCGGATTTCGGAGGAAGTCCACT
>probe:Drosophila_2:1635236_at:350:373; Interrogation_Position=387; Antisense; GAAGTCCACTGTGGTCTACTACGCT
>probe:Drosophila_2:1635236_at:29:535; Interrogation_Position=399; Antisense; GGTCTACTACGCTCCAGCGGATTGA
>probe:Drosophila_2:1635236_at:490:713; Interrogation_Position=44; Antisense; TTCTACATGGCCATGGCGGCGCCAA
>probe:Drosophila_2:1635236_at:293:69; Interrogation_Position=56; Antisense; ATGGCGGCGCCAACGCACAGCATCA

Paste this into a BLAST search page for me
ATGACTGATCTGTCGCCGACCACCTTGACCAAGATCCACCGCCAGAGCAGGACCACCTCTGGGTTTCTACATGGCGCTCTTCTCCTACTTCGGAAACGAGTACTTCGGAAACGAGCAGGATCACGAGCAGGATCACGAGCGCAAGAAGTCTCACGAGCGCAAGAAGTCGGAGACTAGTCGGAGACTTCGTTCTTTAATCTGACTTCGTTCTTTAATCTCGGATTTTCTCGGATTTCGGAGGAAGTCCACTGAAGTCCACTGTGGTCTACTACGCTGGTCTACTACGCTCCAGCGGATTGATTCTACATGGCCATGGCGGCGCCAAATGGCGGCGCCAACGCACAGCATCA

Full Affymetrix probeset data:

Annotations for 1635236_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720