Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635237_at:

>probe:Drosophila_2:1635237_at:87:281; Interrogation_Position=1721; Antisense; CTCGTCGTCGTCGATTAGTCTGGAA
>probe:Drosophila_2:1635237_at:261:511; Interrogation_Position=1749; Antisense; GTGAACAAGCTCACCACGTCGGCGG
>probe:Drosophila_2:1635237_at:497:159; Interrogation_Position=1797; Antisense; ACAACCTACATGTCTGTGGGTGGAC
>probe:Drosophila_2:1635237_at:94:521; Interrogation_Position=1816; Antisense; GTGGACAGGCGCTGCTCGCCATGAC
>probe:Drosophila_2:1635237_at:425:507; Interrogation_Position=1890; Antisense; GTGCCCGCCGGAATGATTGCCATGA
>probe:Drosophila_2:1635237_at:663:563; Interrogation_Position=1899; Antisense; GGAATGATTGCCATGAACCTGCCCA
>probe:Drosophila_2:1635237_at:640:605; Interrogation_Position=1951; Antisense; TGACCATCGGCGAGAACGGACTCGT
>probe:Drosophila_2:1635237_at:261:497; Interrogation_Position=1994; Antisense; GGGCGAATGGTCGTACGATCCCAAC
>probe:Drosophila_2:1635237_at:300:203; Interrogation_Position=2040; Antisense; AACCAGGTGTCCTACGGCGACATGG
>probe:Drosophila_2:1635237_at:605:399; Interrogation_Position=2058; Antisense; GACATGGTGGCCTGCGACAACGACG
>probe:Drosophila_2:1635237_at:271:199; Interrogation_Position=2076; Antisense; AACGACGCCTGTCCCTACGAGTGGT
>probe:Drosophila_2:1635237_at:727:209; Interrogation_Position=2193; Antisense; AAGAACTGAGGCTGACTGCGCCTGC
>probe:Drosophila_2:1635237_at:454:485; Interrogation_Position=2250; Antisense; GTAGGCACCTGGTCGCGTCGCTAGC
>probe:Drosophila_2:1635237_at:515:635; Interrogation_Position=2267; Antisense; TCGCTAGCGGCTCTTATACTTGTAA

Paste this into a BLAST search page for me
CTCGTCGTCGTCGATTAGTCTGGAAGTGAACAAGCTCACCACGTCGGCGGACAACCTACATGTCTGTGGGTGGACGTGGACAGGCGCTGCTCGCCATGACGTGCCCGCCGGAATGATTGCCATGAGGAATGATTGCCATGAACCTGCCCATGACCATCGGCGAGAACGGACTCGTGGGCGAATGGTCGTACGATCCCAACAACCAGGTGTCCTACGGCGACATGGGACATGGTGGCCTGCGACAACGACGAACGACGCCTGTCCCTACGAGTGGTAAGAACTGAGGCTGACTGCGCCTGCGTAGGCACCTGGTCGCGTCGCTAGCTCGCTAGCGGCTCTTATACTTGTAA

Full Affymetrix probeset data:

Annotations for 1635237_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime