Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635239_at:

>probe:Drosophila_2:1635239_at:482:327; Interrogation_Position=284; Antisense; GCGATGAGCCGCGTCAGTTAAACTG
>probe:Drosophila_2:1635239_at:308:589; Interrogation_Position=307; Antisense; TGGTCGGGCAACAAGCCACCAGGAT
>probe:Drosophila_2:1635239_at:616:451; Interrogation_Position=329; Antisense; GATCTGGCGAGGAAACGGACTCCCT
>probe:Drosophila_2:1635239_at:650:427; Interrogation_Position=362; Antisense; GAGATTTCACCCTGCGGGAGAGCAA
>probe:Drosophila_2:1635239_at:620:141; Interrogation_Position=396; Antisense; ACTGCTGACCAAGCGGATCACCAAG
>probe:Drosophila_2:1635239_at:402:211; Interrogation_Position=421; Antisense; AAGAACATTGAGTGGCGCATCCGCA
>probe:Drosophila_2:1635239_at:531:669; Interrogation_Position=454; Antisense; TACTCCCTGGACACATACAGCGTAA
>probe:Drosophila_2:1635239_at:263:109; Interrogation_Position=491; Antisense; AGAAGCGTGCCATAGTCGTGCGCAC
>probe:Drosophila_2:1635239_at:711:505; Interrogation_Position=508; Antisense; GTGCGCACCTCGAACAAGAAGTACT
>probe:Drosophila_2:1635239_at:631:373; Interrogation_Position=525; Antisense; GAAGTACTACAAGGTCATCCCGGTC
>probe:Drosophila_2:1635239_at:181:187; Interrogation_Position=613; Antisense; AACACGCTGATCATTACCTACCAGA
>probe:Drosophila_2:1635239_at:499:391; Interrogation_Position=636; Antisense; GAAACCAGATATCCTCTGCGAGATG
>probe:Drosophila_2:1635239_at:682:153; Interrogation_Position=666; Antisense; ACAGGTGCTGCTTCTGCTCAAGAAT
>probe:Drosophila_2:1635239_at:51:41; Interrogation_Position=716; Antisense; ATCTGCTGAAGGGTCTGATGGCCAA

Paste this into a BLAST search page for me
GCGATGAGCCGCGTCAGTTAAACTGTGGTCGGGCAACAAGCCACCAGGATGATCTGGCGAGGAAACGGACTCCCTGAGATTTCACCCTGCGGGAGAGCAAACTGCTGACCAAGCGGATCACCAAGAAGAACATTGAGTGGCGCATCCGCATACTCCCTGGACACATACAGCGTAAAGAAGCGTGCCATAGTCGTGCGCACGTGCGCACCTCGAACAAGAAGTACTGAAGTACTACAAGGTCATCCCGGTCAACACGCTGATCATTACCTACCAGAGAAACCAGATATCCTCTGCGAGATGACAGGTGCTGCTTCTGCTCAAGAATATCTGCTGAAGGGTCTGATGGCCAA

Full Affymetrix probeset data:

Annotations for 1635239_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime