Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635240_at:

>probe:Drosophila_2:1635240_at:353:261; Interrogation_Position=1831; Antisense; CAGCGCGATGCGTGTCCAAGTGCAC
>probe:Drosophila_2:1635240_at:351:251; Interrogation_Position=1847; Antisense; CAAGTGCACGCGGACATCGATGATC
>probe:Drosophila_2:1635240_at:186:449; Interrogation_Position=1868; Antisense; GATCCAAATATTTCAGGCTCCCTGC
>probe:Drosophila_2:1635240_at:433:373; Interrogation_Position=1918; Antisense; GAAGTGCGCCAACTGTAACCGCGAA
>probe:Drosophila_2:1635240_at:590:595; Interrogation_Position=1931; Antisense; TGTAACCGCGAAGCATTGGCCGAGT
>probe:Drosophila_2:1635240_at:192:433; Interrogation_Position=1952; Antisense; GAGTGCTCACTGTGCCGAAAGACGC
>probe:Drosophila_2:1635240_at:272:393; Interrogation_Position=1968; Antisense; GAAAGACGCCGTACTGCTCGGAGTT
>probe:Drosophila_2:1635240_at:701:143; Interrogation_Position=1980; Antisense; ACTGCTCGGAGTTCTGCCAGCGGAA
>probe:Drosophila_2:1635240_at:359:349; Interrogation_Position=2059; Antisense; GCAGGTCATGCTGTTGATCGACGAT
>probe:Drosophila_2:1635240_at:482:43; Interrogation_Position=2075; Antisense; ATCGACGATCAGTCCTAAGCAACGT
>probe:Drosophila_2:1635240_at:397:87; Interrogation_Position=2168; Antisense; AGTCGCTAAAGTCCTTGCAGTTCGG
>probe:Drosophila_2:1635240_at:501:721; Interrogation_Position=2182; Antisense; TTGCAGTTCGGTTCAGGTCAAACAC
>probe:Drosophila_2:1635240_at:576:171; Interrogation_Position=2254; Antisense; AAAGTTCCCATTAGAAGGCCTGCAT
>probe:Drosophila_2:1635240_at:544:67; Interrogation_Position=2269; Antisense; AGGCCTGCATCCTCTTAGACGTATG

Paste this into a BLAST search page for me
CAGCGCGATGCGTGTCCAAGTGCACCAAGTGCACGCGGACATCGATGATCGATCCAAATATTTCAGGCTCCCTGCGAAGTGCGCCAACTGTAACCGCGAATGTAACCGCGAAGCATTGGCCGAGTGAGTGCTCACTGTGCCGAAAGACGCGAAAGACGCCGTACTGCTCGGAGTTACTGCTCGGAGTTCTGCCAGCGGAAGCAGGTCATGCTGTTGATCGACGATATCGACGATCAGTCCTAAGCAACGTAGTCGCTAAAGTCCTTGCAGTTCGGTTGCAGTTCGGTTCAGGTCAAACACAAAGTTCCCATTAGAAGGCCTGCATAGGCCTGCATCCTCTTAGACGTATG

Full Affymetrix probeset data:

Annotations for 1635240_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime