FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635241_at:

>probe:Drosophila_2:1635241_at:432:101; Interrogation_Position=1013; Antisense; AGAGAGCGCGTCATTTGCTTTCATC
>probe:Drosophila_2:1635241_at:663:245; Interrogation_Position=1075; Antisense; AATTCGACCGTTATCTTGCTACAAA
>probe:Drosophila_2:1635241_at:439:231; Interrogation_Position=1098; Antisense; AATGATCGAGGACTTTTGCCGCGAG
>probe:Drosophila_2:1635241_at:337:87; Interrogation_Position=1169; Antisense; AGTCCCAGATCGATACCGCTGACAA
>probe:Drosophila_2:1635241_at:384:9; Interrogation_Position=1215; Antisense; ATTCCTGGAGGATCAGGCCGCCGAA
>probe:Drosophila_2:1635241_at:291:333; Interrogation_Position=1281; Antisense; GCTGAAGGCTCAGTTGCGCGACAAA
>probe:Drosophila_2:1635241_at:670:431; Interrogation_Position=1347; Antisense; GAGTCCAGTCCATGGTTCTTATCTA
>probe:Drosophila_2:1635241_at:669:97; Interrogation_Position=804; Antisense; AGATCGTCAGAACTTGCAACAGCAA
>probe:Drosophila_2:1635241_at:296:193; Interrogation_Position=827; Antisense; AACTCAGTCGCACTATTGATCGCAA
>probe:Drosophila_2:1635241_at:122:707; Interrogation_Position=881; Antisense; TTAGGGATCAGCTCTCCCAGTTGAA
>probe:Drosophila_2:1635241_at:562:723; Interrogation_Position=901; Antisense; TTGAACTCTCTGAACCACACGGATT
>probe:Drosophila_2:1635241_at:14:83; Interrogation_Position=932; Antisense; AGGGATACGGCTTGGGCACAATGAA
>probe:Drosophila_2:1635241_at:686:541; Interrogation_Position=973; Antisense; GGATTGGATCAATCATCGGCCAGTT
>probe:Drosophila_2:1635241_at:719:91; Interrogation_Position=994; Antisense; AGTTTTCTTGCCCTCCAAGAGAGAG

Paste this into a BLAST search page for me
AGAGAGCGCGTCATTTGCTTTCATCAATTCGACCGTTATCTTGCTACAAAAATGATCGAGGACTTTTGCCGCGAGAGTCCCAGATCGATACCGCTGACAAATTCCTGGAGGATCAGGCCGCCGAAGCTGAAGGCTCAGTTGCGCGACAAAGAGTCCAGTCCATGGTTCTTATCTAAGATCGTCAGAACTTGCAACAGCAAAACTCAGTCGCACTATTGATCGCAATTAGGGATCAGCTCTCCCAGTTGAATTGAACTCTCTGAACCACACGGATTAGGGATACGGCTTGGGCACAATGAAGGATTGGATCAATCATCGGCCAGTTAGTTTTCTTGCCCTCCAAGAGAGAG

Full Affymetrix probeset data:

Annotations for 1635241_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720