FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635243_at:

>probe:Drosophila_2:1635243_at:194:721; Interrogation_Position=1012; Antisense; TTGCATCACGATGTATTGACGCCGA
>probe:Drosophila_2:1635243_at:408:45; Interrogation_Position=1101; Antisense; ATCGCTGAAGCTATCCAAACTGGCA
>probe:Drosophila_2:1635243_at:514:223; Interrogation_Position=1140; Antisense; AAGGATTAGTCGTCTCCTGGGACTT
>probe:Drosophila_2:1635243_at:86:697; Interrogation_Position=1169; Antisense; TTTTAGAACTAGATCCCTGGACCGG
>probe:Drosophila_2:1635243_at:448:493; Interrogation_Position=1205; Antisense; GTCACGAGCACATCACCAAGTTGGA
>probe:Drosophila_2:1635243_at:490:119; Interrogation_Position=1241; Antisense; AGCTGAAGCATGTGGCACGTCTCAT
>probe:Drosophila_2:1635243_at:187:497; Interrogation_Position=1259; Antisense; GTCTCATGTTGAACGCACCCGGAAT
>probe:Drosophila_2:1635243_at:729:75; Interrogation_Position=1287; Antisense; AGGAGCAGTGGTGTTTCCGCAGCTA
>probe:Drosophila_2:1635243_at:247:351; Interrogation_Position=1305; Antisense; GCAGCTAGAGCTCGCCGTGAATGTC
>probe:Drosophila_2:1635243_at:591:259; Interrogation_Position=1379; Antisense; CATCCGAGTGGGACTACCGCAGTGG
>probe:Drosophila_2:1635243_at:561:599; Interrogation_Position=1439; Antisense; TGTCTGTCATCGCTTGTCAGTCGAA
>probe:Drosophila_2:1635243_at:386:383; Interrogation_Position=1461; Antisense; GAACGTGCTGCGAGATACCCTGTAT
>probe:Drosophila_2:1635243_at:229:575; Interrogation_Position=1487; Antisense; GGCCGCGTGGACAGGACTCAATTGA
>probe:Drosophila_2:1635243_at:499:553; Interrogation_Position=981; Antisense; GGAGCCTGTCAGTTCAGATCCATAT

Paste this into a BLAST search page for me
TTGCATCACGATGTATTGACGCCGAATCGCTGAAGCTATCCAAACTGGCAAAGGATTAGTCGTCTCCTGGGACTTTTTTAGAACTAGATCCCTGGACCGGGTCACGAGCACATCACCAAGTTGGAAGCTGAAGCATGTGGCACGTCTCATGTCTCATGTTGAACGCACCCGGAATAGGAGCAGTGGTGTTTCCGCAGCTAGCAGCTAGAGCTCGCCGTGAATGTCCATCCGAGTGGGACTACCGCAGTGGTGTCTGTCATCGCTTGTCAGTCGAAGAACGTGCTGCGAGATACCCTGTATGGCCGCGTGGACAGGACTCAATTGAGGAGCCTGTCAGTTCAGATCCATAT

Full Affymetrix probeset data:

Annotations for 1635243_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720