FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635245_at:

>probe:Drosophila_2:1635245_at:83:651; Interrogation_Position=1058; Antisense; TCACCACGCTGGGTAAGCCTGTTGG
>probe:Drosophila_2:1635245_at:388:551; Interrogation_Position=1087; Antisense; GGAGATCTTCTACCCCAATGCGGAG
>probe:Drosophila_2:1635245_at:554:595; Interrogation_Position=1153; Antisense; TGTGCAGGATTTCCAGGCCTACCAG
>probe:Drosophila_2:1635245_at:263:411; Interrogation_Position=1259; Antisense; GACGCCCACTGCGATGGACACGATG
>probe:Drosophila_2:1635245_at:525:399; Interrogation_Position=1275; Antisense; GACACGATGAACTGGGCTGCTTCCA
>probe:Drosophila_2:1635245_at:203:79; Interrogation_Position=1299; Antisense; AGGTGCGTCTCTACTACGACTGGTT
>probe:Drosophila_2:1635245_at:131:669; Interrogation_Position=1361; Antisense; TACTTCGCCAAGTACGTGCGCCGGA
>probe:Drosophila_2:1635245_at:270:95; Interrogation_Position=1398; Antisense; AGTTGTGAACACTTCCTGGACAGGA
>probe:Drosophila_2:1635245_at:460:169; Interrogation_Position=1488; Antisense; AAAGGCTCATTCTAGTAATCCACCC
>probe:Drosophila_2:1635245_at:156:123; Interrogation_Position=1524; Antisense; AGCCCTATACGGATCACGCAGAGTT
>probe:Drosophila_2:1635245_at:274:351; Interrogation_Position=1550; Antisense; GCAGTTCGTGCATCTACCAGATACA
>probe:Drosophila_2:1635245_at:309:91; Interrogation_Position=1568; Antisense; AGATACAATCTTAACCTAGGCGGTT
>probe:Drosophila_2:1635245_at:155:707; Interrogation_Position=1591; Antisense; TTAGCTCCCTCTTTCGACTGATTAA
>probe:Drosophila_2:1635245_at:472:311; Interrogation_Position=1616; Antisense; GCCAAGAGCAGTGCATTTCTACTAA

Paste this into a BLAST search page for me
TCACCACGCTGGGTAAGCCTGTTGGGGAGATCTTCTACCCCAATGCGGAGTGTGCAGGATTTCCAGGCCTACCAGGACGCCCACTGCGATGGACACGATGGACACGATGAACTGGGCTGCTTCCAAGGTGCGTCTCTACTACGACTGGTTTACTTCGCCAAGTACGTGCGCCGGAAGTTGTGAACACTTCCTGGACAGGAAAAGGCTCATTCTAGTAATCCACCCAGCCCTATACGGATCACGCAGAGTTGCAGTTCGTGCATCTACCAGATACAAGATACAATCTTAACCTAGGCGGTTTTAGCTCCCTCTTTCGACTGATTAAGCCAAGAGCAGTGCATTTCTACTAA

Full Affymetrix probeset data:

Annotations for 1635245_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720