FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635246_at:

>probe:Drosophila_2:1635246_at:128:307; Interrogation_Position=2321; Antisense; CCTGATCAACGAGCACATGGCGGTA
>probe:Drosophila_2:1635246_at:518:593; Interrogation_Position=2360; Antisense; TGGGCTCTCGCACAAGATCTATTTG
>probe:Drosophila_2:1635246_at:260:57; Interrogation_Position=2404; Antisense; ATGAGAACGACTTCATCCCGATCCG
>probe:Drosophila_2:1635246_at:67:447; Interrogation_Position=2423; Antisense; GATCCGCTGGATGCCACTTGAGAGC
>probe:Drosophila_2:1635246_at:416:345; Interrogation_Position=2446; Antisense; GCATACTGTACAACAAGTTCTCGCT
>probe:Drosophila_2:1635246_at:189:217; Interrogation_Position=2460; Antisense; AAGTTCTCGCTTGAGTCGGATGTGT
>probe:Drosophila_2:1635246_at:417:29; Interrogation_Position=2489; Antisense; ATACGGCATCTGTCTGTGGGAGGTC
>probe:Drosophila_2:1635246_at:378:307; Interrogation_Position=2523; Antisense; GCCTTGCAGCCCTACTTTGGGTTAA
>probe:Drosophila_2:1635246_at:198:523; Interrogation_Position=2539; Antisense; TTGGGTTAACCCACGAGGAGGTGAT
>probe:Drosophila_2:1635246_at:429:223; Interrogation_Position=2574; Antisense; AAGGAGGGCAACGTACTCGGCTGTC
>probe:Drosophila_2:1635246_at:39:607; Interrogation_Position=2629; Antisense; TGATGCGTCGCTGCTGGAACCGCAA
>probe:Drosophila_2:1635246_at:282:85; Interrogation_Position=2658; Antisense; AGTGAGCGACCTGGCTTCGCCGAGA
>probe:Drosophila_2:1635246_at:727:185; Interrogation_Position=2776; Antisense; AACAGAACGATCGTCCGTTGTCCTT
>probe:Drosophila_2:1635246_at:470:525; Interrogation_Position=2857; Antisense; GGGAATGCCATCATCTTAACACTTG

Paste this into a BLAST search page for me
CCTGATCAACGAGCACATGGCGGTATGGGCTCTCGCACAAGATCTATTTGATGAGAACGACTTCATCCCGATCCGGATCCGCTGGATGCCACTTGAGAGCGCATACTGTACAACAAGTTCTCGCTAAGTTCTCGCTTGAGTCGGATGTGTATACGGCATCTGTCTGTGGGAGGTCGCCTTGCAGCCCTACTTTGGGTTAATTGGGTTAACCCACGAGGAGGTGATAAGGAGGGCAACGTACTCGGCTGTCTGATGCGTCGCTGCTGGAACCGCAAAGTGAGCGACCTGGCTTCGCCGAGAAACAGAACGATCGTCCGTTGTCCTTGGGAATGCCATCATCTTAACACTTG

Full Affymetrix probeset data:

Annotations for 1635246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720