FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635247_at:

>probe:Drosophila_2:1635247_at:247:227; Interrogation_Position=250; Antisense; AAGGCTGAGGCCAAAGCGCTGCTTG
>probe:Drosophila_2:1635247_at:256:231; Interrogation_Position=282; Antisense; AATGTCATCCATTAACACGCAGCGA
>probe:Drosophila_2:1635247_at:270:455; Interrogation_Position=324; Antisense; GATCAACCGCCAGATGATTCTCGAG
>probe:Drosophila_2:1635247_at:240:111; Interrogation_Position=440; Antisense; AGAATCTGAACCGATCCATGGCCGA
>probe:Drosophila_2:1635247_at:221:347; Interrogation_Position=475; Antisense; GCATCCAACATTGACGAGGCCATCG
>probe:Drosophila_2:1635247_at:4:71; Interrogation_Position=491; Antisense; AGGCCATCGTGGTGCTCAGTGTAAA
>probe:Drosophila_2:1635247_at:604:237; Interrogation_Position=583; Antisense; AATCTGCCCCGCATTAAGGCTGAGA
>probe:Drosophila_2:1635247_at:508:709; Interrogation_Position=596; Antisense; TTAAGGCTGAGAATCCTTCCCTTCG
>probe:Drosophila_2:1635247_at:483:635; Interrogation_Position=618; Antisense; TCGCATGTCCCAGTGGAAGCAGCTT
>probe:Drosophila_2:1635247_at:673:559; Interrogation_Position=656; Antisense; GGAACAAGTCACCAGACAACCCATT
>probe:Drosophila_2:1635247_at:132:203; Interrogation_Position=682; Antisense; AACCAGGCGCGCTAAGTGATCCAAG
>probe:Drosophila_2:1635247_at:546:413; Interrogation_Position=707; Antisense; GACCAAGACTGTTTGCTGCCTAGCA
>probe:Drosophila_2:1635247_at:344:239; Interrogation_Position=742; Antisense; AATCAAAACGTTCTGTAGCACCTTT
>probe:Drosophila_2:1635247_at:678:675; Interrogation_Position=757; Antisense; TAGCACCTTTGAACTGTACGCAGAA

Paste this into a BLAST search page for me
AAGGCTGAGGCCAAAGCGCTGCTTGAATGTCATCCATTAACACGCAGCGAGATCAACCGCCAGATGATTCTCGAGAGAATCTGAACCGATCCATGGCCGAGCATCCAACATTGACGAGGCCATCGAGGCCATCGTGGTGCTCAGTGTAAAAATCTGCCCCGCATTAAGGCTGAGATTAAGGCTGAGAATCCTTCCCTTCGTCGCATGTCCCAGTGGAAGCAGCTTGGAACAAGTCACCAGACAACCCATTAACCAGGCGCGCTAAGTGATCCAAGGACCAAGACTGTTTGCTGCCTAGCAAATCAAAACGTTCTGTAGCACCTTTTAGCACCTTTGAACTGTACGCAGAA

Full Affymetrix probeset data:

Annotations for 1635247_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720