FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635251_at:

>probe:Drosophila_2:1635251_at:142:131; Interrogation_Position=490; Antisense; ACCGAGAAATGTGGCAGGCGAGTTT
>probe:Drosophila_2:1635251_at:163:277; Interrogation_Position=521; Antisense; CTTTAGCTGGACATTGCTGGAGTTC
>probe:Drosophila_2:1635251_at:520:331; Interrogation_Position=536; Antisense; GCTGGAGTTCGGAGTTGGCAACTTT
>probe:Drosophila_2:1635251_at:502:383; Interrogation_Position=570; Antisense; GAACTTTCCGTGCAAGTGGTCCAAT
>probe:Drosophila_2:1635251_at:217:519; Interrogation_Position=585; Antisense; GTGGTCCAATATAATTAGATGCCTG
>probe:Drosophila_2:1635251_at:290:221; Interrogation_Position=611; Antisense; AAGTGGACAGCAGTTCGAGCGGAAA
>probe:Drosophila_2:1635251_at:639:179; Interrogation_Position=679; Antisense; AAAAACTTTGCTCTGCCACTTAGCT
>probe:Drosophila_2:1635251_at:484:279; Interrogation_Position=689; Antisense; CTCTGCCACTTAGCTGTTAAACTGT
>probe:Drosophila_2:1635251_at:59:179; Interrogation_Position=707; Antisense; AAACTGTGTTTATTGTCTCGCCTGC
>probe:Drosophila_2:1635251_at:519:643; Interrogation_Position=722; Antisense; TCTCGCCTGCAAGTTGTCGGTAGAA
>probe:Drosophila_2:1635251_at:624:445; Interrogation_Position=773; Antisense; GATGCAAATCACTTTCAAACGACTT
>probe:Drosophila_2:1635251_at:309:15; Interrogation_Position=813; Antisense; GACTTTAGGTTCACAATTTAATCGA
>probe:Drosophila_2:1635251_at:699:697; Interrogation_Position=850; Antisense; TTTTTCCTTTATAACTTCTACCATG
>probe:Drosophila_2:1635251_at:272:643; Interrogation_Position=866; Antisense; TCTACCATGTACAAGGCGCCTAAAG

Paste this into a BLAST search page for me
ACCGAGAAATGTGGCAGGCGAGTTTCTTTAGCTGGACATTGCTGGAGTTCGCTGGAGTTCGGAGTTGGCAACTTTGAACTTTCCGTGCAAGTGGTCCAATGTGGTCCAATATAATTAGATGCCTGAAGTGGACAGCAGTTCGAGCGGAAAAAAAACTTTGCTCTGCCACTTAGCTCTCTGCCACTTAGCTGTTAAACTGTAAACTGTGTTTATTGTCTCGCCTGCTCTCGCCTGCAAGTTGTCGGTAGAAGATGCAAATCACTTTCAAACGACTTGACTTTAGGTTCACAATTTAATCGATTTTTCCTTTATAACTTCTACCATGTCTACCATGTACAAGGCGCCTAAAG

Full Affymetrix probeset data:

Annotations for 1635251_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720