FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635254_at:

>probe:Drosophila_2:1635254_at:165:339; Interrogation_Position=291; Antisense; GCTCTACGGCGCAATCGGTTGGATC
>probe:Drosophila_2:1635254_at:264:449; Interrogation_Position=312; Antisense; GATCCGGGCCATTGCTTACTTTGTG
>probe:Drosophila_2:1635254_at:392:457; Interrogation_Position=357; Antisense; GATAGGCTATGGTCTCCTGGTGGCT
>probe:Drosophila_2:1635254_at:23:717; Interrogation_Position=383; Antisense; TTCTGCCTGGGAACTCCATCAAGGG
>probe:Drosophila_2:1635254_at:227:203; Interrogation_Position=414; Antisense; CAACCCGTCGGGTGTTTGTGTGACA
>probe:Drosophila_2:1635254_at:664:13; Interrogation_Position=490; Antisense; ATTACCTGCTGCCTGGTCATGGTGG
>probe:Drosophila_2:1635254_at:649:207; Interrogation_Position=544; Antisense; AAGCTGCAGGATTCGGTGCCCGTGA
>probe:Drosophila_2:1635254_at:339:597; Interrogation_Position=589; Antisense; TGTCTGATCCTCACAGCGGTTGGTA
>probe:Drosophila_2:1635254_at:96:581; Interrogation_Position=609; Antisense; TGGTATTTCGGGTCTCTTCACGGGA
>probe:Drosophila_2:1635254_at:687:553; Interrogation_Position=631; Antisense; GGAGCCAGCATGAATCCGACCAGAT
>probe:Drosophila_2:1635254_at:225:117; Interrogation_Position=666; Antisense; AGCTGTTTGGAACGACTCCTGGGCA
>probe:Drosophila_2:1635254_at:339:75; Interrogation_Position=726; Antisense; AGGAGCTGTGACCTCGCTGATCTAT
>probe:Drosophila_2:1635254_at:106:335; Interrogation_Position=741; Antisense; GCTGATCTATCGCATGGCCTTTAAG
>probe:Drosophila_2:1635254_at:649:437; Interrogation_Position=786; Antisense; GAGGACTTCCGATGCCAAGATACGA

Paste this into a BLAST search page for me
GCTCTACGGCGCAATCGGTTGGATCGATCCGGGCCATTGCTTACTTTGTGGATAGGCTATGGTCTCCTGGTGGCTTTCTGCCTGGGAACTCCATCAAGGGCAACCCGTCGGGTGTTTGTGTGACAATTACCTGCTGCCTGGTCATGGTGGAAGCTGCAGGATTCGGTGCCCGTGATGTCTGATCCTCACAGCGGTTGGTATGGTATTTCGGGTCTCTTCACGGGAGGAGCCAGCATGAATCCGACCAGATAGCTGTTTGGAACGACTCCTGGGCAAGGAGCTGTGACCTCGCTGATCTATGCTGATCTATCGCATGGCCTTTAAGGAGGACTTCCGATGCCAAGATACGA

Full Affymetrix probeset data:

Annotations for 1635254_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720