FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635257_at:

>probe:Drosophila_2:1635257_at:65:621; Interrogation_Position=1842; Antisense; TGCGGAAAGAGTTTTTCCCGGCGCT
>probe:Drosophila_2:1635257_at:90:551; Interrogation_Position=1901; Antisense; GGAGAAGAACTACGCCTGCCAGTAT
>probe:Drosophila_2:1635257_at:407:1; Interrogation_Position=1922; Antisense; GTATTGTGACAAGACCTTCCGGGCC
>probe:Drosophila_2:1635257_at:406:335; Interrogation_Position=1948; Antisense; GCTCCTACCTGCTCAGTCATATTAA
>probe:Drosophila_2:1635257_at:719:317; Interrogation_Position=1991; Antisense; GCCGTACGAGTGTTCCATCTGTGAA
>probe:Drosophila_2:1635257_at:243:161; Interrogation_Position=2019; Antisense; AAATTTCGAGTCTCAGGCGATCTCA
>probe:Drosophila_2:1635257_at:645:69; Interrogation_Position=2033; Antisense; AGGCGATCTCAAGCGACATTCAAGG
>probe:Drosophila_2:1635257_at:179:463; Interrogation_Position=2057; Antisense; GATTCACGATCCCAGCAGAACAAGC
>probe:Drosophila_2:1635257_at:388:525; Interrogation_Position=2113; Antisense; GGGCAGCCGCGAGCAATAAGCAATT
>probe:Drosophila_2:1635257_at:638:99; Interrogation_Position=2147; Antisense; AGAGGATGACGAGTTGGCCACCAAT
>probe:Drosophila_2:1635257_at:729:161; Interrogation_Position=2179; Antisense; ACAATAAGTCTGACGCCATGCGCGA
>probe:Drosophila_2:1635257_at:304:315; Interrogation_Position=2193; Antisense; GCCATGCGCGACCAAACTGGACAGA
>probe:Drosophila_2:1635257_at:684:521; Interrogation_Position=2225; Antisense; GGGCTTATAGCCATGCTGTGCCAAG
>probe:Drosophila_2:1635257_at:729:333; Interrogation_Position=2239; Antisense; GCTGTGCCAAGGTTTCTTCAAAGTA

Paste this into a BLAST search page for me
TGCGGAAAGAGTTTTTCCCGGCGCTGGAGAAGAACTACGCCTGCCAGTATGTATTGTGACAAGACCTTCCGGGCCGCTCCTACCTGCTCAGTCATATTAAGCCGTACGAGTGTTCCATCTGTGAAAAATTTCGAGTCTCAGGCGATCTCAAGGCGATCTCAAGCGACATTCAAGGGATTCACGATCCCAGCAGAACAAGCGGGCAGCCGCGAGCAATAAGCAATTAGAGGATGACGAGTTGGCCACCAATACAATAAGTCTGACGCCATGCGCGAGCCATGCGCGACCAAACTGGACAGAGGGCTTATAGCCATGCTGTGCCAAGGCTGTGCCAAGGTTTCTTCAAAGTA

Full Affymetrix probeset data:

Annotations for 1635257_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720