FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635259_at:

>probe:Drosophila_2:1635259_at:535:413; Interrogation_Position=1003; Antisense; GACCAAATGCTAGTCGTCTACCTGG
>probe:Drosophila_2:1635259_at:678:225; Interrogation_Position=1223; Antisense; AAGGCGGCAAGGGTTCGCGCAAATA
>probe:Drosophila_2:1635259_at:51:75; Interrogation_Position=1301; Antisense; AGGACTAGCTGCTGCTTCTTCTGTT
>probe:Drosophila_2:1635259_at:3:277; Interrogation_Position=1315; Antisense; CTTCTTCTGTTCTCCAGGAAGTGGA
>probe:Drosophila_2:1635259_at:365:73; Interrogation_Position=1330; Antisense; AGGAAGTGGAACTCATCTGCAGACC
>probe:Drosophila_2:1635259_at:555:641; Interrogation_Position=1345; Antisense; TCTGCAGACCATACGGCGAGGGTGT
>probe:Drosophila_2:1635259_at:87:517; Interrogation_Position=1366; Antisense; GTGTGCAGTGGCCTCAGAAATCAAG
>probe:Drosophila_2:1635259_at:30:653; Interrogation_Position=1386; Antisense; TCAAGCATTGCTACCATTCATCGTT
>probe:Drosophila_2:1635259_at:452:673; Interrogation_Position=1397; Antisense; TACCATTCATCGTTCATTTTCCACA
>probe:Drosophila_2:1635259_at:463:695; Interrogation_Position=1414; Antisense; TTTCCACACGAAATTAAGCTCCCTC
>probe:Drosophila_2:1635259_at:123:119; Interrogation_Position=1430; Antisense; AGCTCCCTCTTATTATTTCGCGTAA
>probe:Drosophila_2:1635259_at:408:129; Interrogation_Position=911; Antisense; ACCAGATTGTCTACCAGCTGCAGGA
>probe:Drosophila_2:1635259_at:353:131; Interrogation_Position=944; Antisense; ACCTGCTGCCCGATATAACCAATGA
>probe:Drosophila_2:1635259_at:278:231; Interrogation_Position=964; Antisense; AATGACCAGTTCACGGGCACAATGT

Paste this into a BLAST search page for me
GACCAAATGCTAGTCGTCTACCTGGAAGGCGGCAAGGGTTCGCGCAAATAAGGACTAGCTGCTGCTTCTTCTGTTCTTCTTCTGTTCTCCAGGAAGTGGAAGGAAGTGGAACTCATCTGCAGACCTCTGCAGACCATACGGCGAGGGTGTGTGTGCAGTGGCCTCAGAAATCAAGTCAAGCATTGCTACCATTCATCGTTTACCATTCATCGTTCATTTTCCACATTTCCACACGAAATTAAGCTCCCTCAGCTCCCTCTTATTATTTCGCGTAAACCAGATTGTCTACCAGCTGCAGGAACCTGCTGCCCGATATAACCAATGAAATGACCAGTTCACGGGCACAATGT

Full Affymetrix probeset data:

Annotations for 1635259_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720