FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635260_at:

>probe:Drosophila_2:1635260_at:70:571; Interrogation_Position=2327; Antisense; GGCTATCACATGCAGAACGATGCTG
>probe:Drosophila_2:1635260_at:371:387; Interrogation_Position=2356; Antisense; GAACAACATTCCTATCTACCAGCAG
>probe:Drosophila_2:1635260_at:230:539; Interrogation_Position=2385; Antisense; GGTAAGACCGCTGCACTAAAACAGA
>probe:Drosophila_2:1635260_at:683:185; Interrogation_Position=2404; Antisense; AACAGAGACCTTCACTTGGTTCGCT
>probe:Drosophila_2:1635260_at:441:541; Interrogation_Position=2421; Antisense; GGTTCGCTTTGAATTGCCCGAGCAA
>probe:Drosophila_2:1635260_at:611:7; Interrogation_Position=2433; Antisense; ATTGCCCGAGCAACTTTAAGCTTTG
>probe:Drosophila_2:1635260_at:630:707; Interrogation_Position=2448; Antisense; TTAAGCTTTGTCTTCATTCTGACAA
>probe:Drosophila_2:1635260_at:351:269; Interrogation_Position=2481; Antisense; CATCGAGTATGTTAGTTTTGGCCAA
>probe:Drosophila_2:1635260_at:197:477; Interrogation_Position=2495; Antisense; GTTTTGGCCAACTTGCCGAGAAACG
>probe:Drosophila_2:1635260_at:491:563; Interrogation_Position=2519; Antisense; GGAAGTTGTCAAATCTCTGCTATGT
>probe:Drosophila_2:1635260_at:350:375; Interrogation_Position=2553; Antisense; GAAGAGCAATTGTCAGTGAACCAAA
>probe:Drosophila_2:1635260_at:360:379; Interrogation_Position=2570; Antisense; GAACCAAATATGTCGACTATCCTTT
>probe:Drosophila_2:1635260_at:514:649; Interrogation_Position=2622; Antisense; TCAAGTATACCCTTACGAGTTTTCG
>probe:Drosophila_2:1635260_at:19:601; Interrogation_Position=2742; Antisense; TGTATTCAACAGCACGTATAACTTT

Paste this into a BLAST search page for me
GGCTATCACATGCAGAACGATGCTGGAACAACATTCCTATCTACCAGCAGGGTAAGACCGCTGCACTAAAACAGAAACAGAGACCTTCACTTGGTTCGCTGGTTCGCTTTGAATTGCCCGAGCAAATTGCCCGAGCAACTTTAAGCTTTGTTAAGCTTTGTCTTCATTCTGACAACATCGAGTATGTTAGTTTTGGCCAAGTTTTGGCCAACTTGCCGAGAAACGGGAAGTTGTCAAATCTCTGCTATGTGAAGAGCAATTGTCAGTGAACCAAAGAACCAAATATGTCGACTATCCTTTTCAAGTATACCCTTACGAGTTTTCGTGTATTCAACAGCACGTATAACTTT

Full Affymetrix probeset data:

Annotations for 1635260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720