FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635261_at:

>probe:Drosophila_2:1635261_at:572:725; Interrogation_Position=112; Antisense; TTGATATTTCCACGACAAGCGCCTA
>probe:Drosophila_2:1635261_at:490:7; Interrogation_Position=151; Antisense; ATTGCTGGTATTGGTATTCCTGCGG
>probe:Drosophila_2:1635261_at:716:687; Interrogation_Position=165; Antisense; TATTCCTGCGGATCTTGAGTATGAA
>probe:Drosophila_2:1635261_at:83:485; Interrogation_Position=183; Antisense; GTATGAATCCCTGACTGTTGGCTAT
>probe:Drosophila_2:1635261_at:271:727; Interrogation_Position=200; Antisense; TTGGCTATGTCCTTAAAGCGGAGTA
>probe:Drosophila_2:1635261_at:535:197; Interrogation_Position=215; Antisense; AAGCGGAGTACTATCTGCCCTATAA
>probe:Drosophila_2:1635261_at:572:623; Interrogation_Position=230; Antisense; TGCCCTATAATGCAACCGTCTACAG
>probe:Drosophila_2:1635261_at:684:681; Interrogation_Position=24; Antisense; TATGTGGCTTTCAGTTTGTGCAACG
>probe:Drosophila_2:1635261_at:234:565; Interrogation_Position=254; Antisense; GGCAAAATCCACTGTTTCCTGAATA
>probe:Drosophila_2:1635261_at:213:673; Interrogation_Position=293; Antisense; TAGACGCCCAGGATCAACGGAAATT
>probe:Drosophila_2:1635261_at:421:391; Interrogation_Position=324; Antisense; GAAACCCACAGATTTGCGCTGGCAA
>probe:Drosophila_2:1635261_at:119:481; Interrogation_Position=37; Antisense; GTTTGTGCAACGCTTTGCTTGATTT
>probe:Drosophila_2:1635261_at:473:227; Interrogation_Position=376; Antisense; AATGGGTATGGTCATCTCACTTTTA
>probe:Drosophila_2:1635261_at:97:599; Interrogation_Position=87; Antisense; TGTACACTCCAGATCTAAACGTTTC

Paste this into a BLAST search page for me
TTGATATTTCCACGACAAGCGCCTAATTGCTGGTATTGGTATTCCTGCGGTATTCCTGCGGATCTTGAGTATGAAGTATGAATCCCTGACTGTTGGCTATTTGGCTATGTCCTTAAAGCGGAGTAAAGCGGAGTACTATCTGCCCTATAATGCCCTATAATGCAACCGTCTACAGTATGTGGCTTTCAGTTTGTGCAACGGGCAAAATCCACTGTTTCCTGAATATAGACGCCCAGGATCAACGGAAATTGAAACCCACAGATTTGCGCTGGCAAGTTTGTGCAACGCTTTGCTTGATTTAATGGGTATGGTCATCTCACTTTTATGTACACTCCAGATCTAAACGTTTC

Full Affymetrix probeset data:

Annotations for 1635261_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720