Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635263_at:

>probe:Drosophila_2:1635263_at:282:375; Interrogation_Position=107; Antisense; GAAGATGTCGCTCAGGCAAACAAGT
>probe:Drosophila_2:1635263_at:641:681; Interrogation_Position=160; Antisense; TATGCTGGTGGGTATTGCCGGATTC
>probe:Drosophila_2:1635263_at:460:319; Interrogation_Position=188; Antisense; GCCGCAGGTTTGATTGGAGCCTACA
>probe:Drosophila_2:1635263_at:607:551; Interrogation_Position=203; Antisense; GGAGCCTACAAATATCGGAACCGAG
>probe:Drosophila_2:1635263_at:459:381; Interrogation_Position=220; Antisense; GAACCGAGGCAGCATGAGCACCAGC
>probe:Drosophila_2:1635263_at:595:121; Interrogation_Position=242; Antisense; AGCGTCTTTCTGATGCAGTTGCGTG
>probe:Drosophila_2:1635263_at:471:201; Interrogation_Position=280; Antisense; AACCGTCGTTGGATGTTTGACAGCC
>probe:Drosophila_2:1635263_at:481:611; Interrogation_Position=297; Antisense; TGACAGCCGGATTGGCGTACACCAT
>probe:Drosophila_2:1635263_at:227:487; Interrogation_Position=331; Antisense; GTACCTGCTCCACGAGGAACCGAAA
>probe:Drosophila_2:1635263_at:537:361; Interrogation_Position=357; Antisense; GCAATACCAGGCCAGACGAATAAAT
>probe:Drosophila_2:1635263_at:572:673; Interrogation_Position=388; Antisense; TAGTAGGATCATCGGCCAAAGACCA
>probe:Drosophila_2:1635263_at:492:663; Interrogation_Position=444; Antisense; TAAACTCATCAAATTGCCTACCTCC
>probe:Drosophila_2:1635263_at:490:309; Interrogation_Position=469; Antisense; CCACCACCTTCATCGAATCAGAAAT
>probe:Drosophila_2:1635263_at:729:55; Interrogation_Position=77; Antisense; ATGAGTTCCAATTCTCTATTCGAAA

Paste this into a BLAST search page for me
GAAGATGTCGCTCAGGCAAACAAGTTATGCTGGTGGGTATTGCCGGATTCGCCGCAGGTTTGATTGGAGCCTACAGGAGCCTACAAATATCGGAACCGAGGAACCGAGGCAGCATGAGCACCAGCAGCGTCTTTCTGATGCAGTTGCGTGAACCGTCGTTGGATGTTTGACAGCCTGACAGCCGGATTGGCGTACACCATGTACCTGCTCCACGAGGAACCGAAAGCAATACCAGGCCAGACGAATAAATTAGTAGGATCATCGGCCAAAGACCATAAACTCATCAAATTGCCTACCTCCCCACCACCTTCATCGAATCAGAAATATGAGTTCCAATTCTCTATTCGAAA

Full Affymetrix probeset data:

Annotations for 1635263_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime