FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635266_at:

>probe:Drosophila_2:1635266_at:32:671; Interrogation_Position=683; Antisense; TACCCCTGGAACTATGTAAGGCAAT
>probe:Drosophila_2:1635266_at:288:681; Interrogation_Position=695; Antisense; TATGTAAGGCAATACGAGAATCGAA
>probe:Drosophila_2:1635266_at:191:367; Interrogation_Position=712; Antisense; GAATCGAAAGCGATATCTGCGCTAT
>probe:Drosophila_2:1635266_at:209:459; Interrogation_Position=723; Antisense; GATATCTGCGCTATTGAACCGCCGA
>probe:Drosophila_2:1635266_at:539:683; Interrogation_Position=725; Antisense; TATCTGCGCTATTGAACCGCCGATA
>probe:Drosophila_2:1635266_at:258:691; Interrogation_Position=734; Antisense; TATTGAACCGCCGATACCCGATATG
>probe:Drosophila_2:1635266_at:231:381; Interrogation_Position=738; Antisense; GAACCGCCGATACCCGATATGCATT
>probe:Drosophila_2:1635266_at:595:299; Interrogation_Position=742; Antisense; CGCCGATACCCGATATGCATTTAGA
>probe:Drosophila_2:1635266_at:561:455; Interrogation_Position=746; Antisense; GATACCCGATATGCATTTAGAACTA
>probe:Drosophila_2:1635266_at:128:301; Interrogation_Position=750; Antisense; CCCGATATGCATTTAGAACTACCTA
>probe:Drosophila_2:1635266_at:650:383; Interrogation_Position=765; Antisense; GAACTACCTATATATAATTGTACAA
>probe:Drosophila_2:1635266_at:166:491; Interrogation_Position=784; Antisense; GTACAAGAGATTAAAGCCAGACACC
>probe:Drosophila_2:1635266_at:23:463; Interrogation_Position=792; Antisense; GATTAAAGCCAGACACCTCAGACAC
>probe:Drosophila_2:1635266_at:341:663; Interrogation_Position=795; Antisense; TAAAGCCAGACACCTCAGACACGAA

Paste this into a BLAST search page for me
TACCCCTGGAACTATGTAAGGCAATTATGTAAGGCAATACGAGAATCGAAGAATCGAAAGCGATATCTGCGCTATGATATCTGCGCTATTGAACCGCCGATATCTGCGCTATTGAACCGCCGATATATTGAACCGCCGATACCCGATATGGAACCGCCGATACCCGATATGCATTCGCCGATACCCGATATGCATTTAGAGATACCCGATATGCATTTAGAACTACCCGATATGCATTTAGAACTACCTAGAACTACCTATATATAATTGTACAAGTACAAGAGATTAAAGCCAGACACCGATTAAAGCCAGACACCTCAGACACTAAAGCCAGACACCTCAGACACGAA

Full Affymetrix probeset data:

Annotations for 1635266_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720