FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635268_at:

>probe:Drosophila_2:1635268_at:437:343; Interrogation_Position=113; Antisense; GCTTGATTGCTGACCAAATTCGCCA
>probe:Drosophila_2:1635268_at:618:261; Interrogation_Position=136; Antisense; CAGCCTACGAGCGATCCAGTTGATA
>probe:Drosophila_2:1635268_at:557:279; Interrogation_Position=184; Antisense; CTAAGCATTCTGCATCTCGAGGATG
>probe:Drosophila_2:1635268_at:489:11; Interrogation_Position=224; Antisense; ATTCGATGCAAAGCTTTCACGTGTC
>probe:Drosophila_2:1635268_at:10:323; Interrogation_Position=249; Antisense; GCCCACTGCTGAATCCTTAAACGAA
>probe:Drosophila_2:1635268_at:134:45; Interrogation_Position=261; Antisense; ATCCTTAAACGAAGTCATGCCAGTG
>probe:Drosophila_2:1635268_at:331:41; Interrogation_Position=296; Antisense; ATCTGGGCGAGATGCTGGATGCCCT
>probe:Drosophila_2:1635268_at:165:611; Interrogation_Position=320; Antisense; TGACCGACGTGATCCTGGTTGAGGA
>probe:Drosophila_2:1635268_at:20:441; Interrogation_Position=439; Antisense; GATGTCGACGAAAATGCTCCAAAAG
>probe:Drosophila_2:1635268_at:276:325; Interrogation_Position=463; Antisense; GCGAACTTAAATTCAGGCTGGATAT
>probe:Drosophila_2:1635268_at:726:237; Interrogation_Position=50; Antisense; AATCAAAGTTGGTGCAATCGCTGGA
>probe:Drosophila_2:1635268_at:142:237; Interrogation_Position=65; Antisense; AATCGCTGGAGGAGTCGACGCCGCC
>probe:Drosophila_2:1635268_at:63:321; Interrogation_Position=84; Antisense; GCCGCCCATCGATGAAGAGGACGTC
>probe:Drosophila_2:1635268_at:416:213; Interrogation_Position=98; Antisense; AAGAGGACGTCATCCGCTTGATTGC

Paste this into a BLAST search page for me
GCTTGATTGCTGACCAAATTCGCCACAGCCTACGAGCGATCCAGTTGATACTAAGCATTCTGCATCTCGAGGATGATTCGATGCAAAGCTTTCACGTGTCGCCCACTGCTGAATCCTTAAACGAAATCCTTAAACGAAGTCATGCCAGTGATCTGGGCGAGATGCTGGATGCCCTTGACCGACGTGATCCTGGTTGAGGAGATGTCGACGAAAATGCTCCAAAAGGCGAACTTAAATTCAGGCTGGATATAATCAAAGTTGGTGCAATCGCTGGAAATCGCTGGAGGAGTCGACGCCGCCGCCGCCCATCGATGAAGAGGACGTCAAGAGGACGTCATCCGCTTGATTGC

Full Affymetrix probeset data:

Annotations for 1635268_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720