FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635269_at:

>probe:Drosophila_2:1635269_at:4:77; Interrogation_Position=345; Antisense; AGGATACGCTGGACTTTTCGCTGCA
>probe:Drosophila_2:1635269_at:296:507; Interrogation_Position=436; Antisense; GTGCCGCGCCATAAGTAGCTGGTCA
>probe:Drosophila_2:1635269_at:727:163; Interrogation_Position=497; Antisense; AAATCATTTCGGGTGTTGCGCAACA
>probe:Drosophila_2:1635269_at:502:73; Interrogation_Position=546; Antisense; AGGACGTATTGGGTCATCCACTTCG
>probe:Drosophila_2:1635269_at:647:47; Interrogation_Position=561; Antisense; ATCCACTTCGCATAGGCGGTTGTAA
>probe:Drosophila_2:1635269_at:85:389; Interrogation_Position=587; Antisense; GAAAAGATTCATCCGCACAGCGTAA
>probe:Drosophila_2:1635269_at:608:173; Interrogation_Position=610; Antisense; AAAGCTCATTTGCAGCGGTGTCCAC
>probe:Drosophila_2:1635269_at:573:533; Interrogation_Position=626; Antisense; GGTGTCCACAACCAGCTGGTGAACA
>probe:Drosophila_2:1635269_at:464:613; Interrogation_Position=645; Antisense; TGAACAATGGATTCTCGCGCCAGAC
>probe:Drosophila_2:1635269_at:269:275; Interrogation_Position=682; Antisense; CTTCTTCCGCTATTAGTTCCACAAA
>probe:Drosophila_2:1635269_at:276:165; Interrogation_Position=704; Antisense; AAATCTGTGTTTGCTTTCCCAGAAA
>probe:Drosophila_2:1635269_at:87:159; Interrogation_Position=782; Antisense; ACACAGAAGCAGTCGTCACGCAGTC
>probe:Drosophila_2:1635269_at:314:275; Interrogation_Position=865; Antisense; CTTGTGGAGTGTCCTGTTGGTCATC
>probe:Drosophila_2:1635269_at:294:135; Interrogation_Position=917; Antisense; ACGCTGTTTCTTGTTCTGGTTACGA

Paste this into a BLAST search page for me
AGGATACGCTGGACTTTTCGCTGCAGTGCCGCGCCATAAGTAGCTGGTCAAAATCATTTCGGGTGTTGCGCAACAAGGACGTATTGGGTCATCCACTTCGATCCACTTCGCATAGGCGGTTGTAAGAAAAGATTCATCCGCACAGCGTAAAAAGCTCATTTGCAGCGGTGTCCACGGTGTCCACAACCAGCTGGTGAACATGAACAATGGATTCTCGCGCCAGACCTTCTTCCGCTATTAGTTCCACAAAAAATCTGTGTTTGCTTTCCCAGAAAACACAGAAGCAGTCGTCACGCAGTCCTTGTGGAGTGTCCTGTTGGTCATCACGCTGTTTCTTGTTCTGGTTACGA

Full Affymetrix probeset data:

Annotations for 1635269_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720