FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635270_at:

>probe:Drosophila_2:1635270_at:722:359; Interrogation_Position=129; Antisense; GAAGAAGGCATTCTACCTTCCCTGG
>probe:Drosophila_2:1635270_at:292:35; Interrogation_Position=175; Antisense; ATCACCGGTGATTGCCTCACACTGT
>probe:Drosophila_2:1635270_at:565:627; Interrogation_Position=187; Antisense; TGCCTCACACTGTTGGCCAATGTCA
>probe:Drosophila_2:1635270_at:65:231; Interrogation_Position=205; Antisense; AATGTCACCATGACTGCCGAAGGGA
>probe:Drosophila_2:1635270_at:155:55; Interrogation_Position=214; Antisense; ATGACTGCCGAAGGGACCACAATGA
>probe:Drosophila_2:1635270_at:580:231; Interrogation_Position=234; Antisense; AATGAGCGAGCACCGCTTGTCCGTG
>probe:Drosophila_2:1635270_at:213:169; Interrogation_Position=271; Antisense; AAATGGGCACCACACGTCTGCCAGG
>probe:Drosophila_2:1635270_at:586:577; Interrogation_Position=294; Antisense; GGCCCCACTGCAAATCTTCAAGACG
>probe:Drosophila_2:1635270_at:255:199; Interrogation_Position=31; Antisense; AACGAATGGCTGACAACTGTTGTAC
>probe:Drosophila_2:1635270_at:629:101; Interrogation_Position=314; Antisense; AGACGCAGCTTTGTCTTAACACCAC
>probe:Drosophila_2:1635270_at:4:261; Interrogation_Position=333; Antisense; CACCACTGCTTTCTTCGAGGCCAAG
>probe:Drosophila_2:1635270_at:232:267; Interrogation_Position=345; Antisense; CTTCGAGGCCAAGGTACCCGCTTAG
>probe:Drosophila_2:1635270_at:31:603; Interrogation_Position=48; Antisense; TGTTGTACCCCAAAGCCCAGAGCTG
>probe:Drosophila_2:1635270_at:135:125; Interrogation_Position=61; Antisense; AGCCCAGAGCTGTGGACATCCGGAA

Paste this into a BLAST search page for me
GAAGAAGGCATTCTACCTTCCCTGGATCACCGGTGATTGCCTCACACTGTTGCCTCACACTGTTGGCCAATGTCAAATGTCACCATGACTGCCGAAGGGAATGACTGCCGAAGGGACCACAATGAAATGAGCGAGCACCGCTTGTCCGTGAAATGGGCACCACACGTCTGCCAGGGGCCCCACTGCAAATCTTCAAGACGAACGAATGGCTGACAACTGTTGTACAGACGCAGCTTTGTCTTAACACCACCACCACTGCTTTCTTCGAGGCCAAGCTTCGAGGCCAAGGTACCCGCTTAGTGTTGTACCCCAAAGCCCAGAGCTGAGCCCAGAGCTGTGGACATCCGGAA

Full Affymetrix probeset data:

Annotations for 1635270_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720