Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635271_at:

>probe:Drosophila_2:1635271_at:219:451; Interrogation_Position=1279; Antisense; GATCGCTGCTCGAAGGCCTTCTTCA
>probe:Drosophila_2:1635271_at:636:379; Interrogation_Position=1347; Antisense; GAAGCCATTCGCCTGTGAGTACTGT
>probe:Drosophila_2:1635271_at:101:511; Interrogation_Position=1361; Antisense; GTGAGTACTGTGACAAGTGCTACCA
>probe:Drosophila_2:1635271_at:103:85; Interrogation_Position=1376; Antisense; AGTGCTACCAGAGCGTTGGCAACCT
>probe:Drosophila_2:1635271_at:536:615; Interrogation_Position=1400; Antisense; TGAATAACCACATGGTGCGCCTGCA
>probe:Drosophila_2:1635271_at:395:65; Interrogation_Position=1411; Antisense; ATGGTGCGCCTGCACGCAGATATCA
>probe:Drosophila_2:1635271_at:181:297; Interrogation_Position=1425; Antisense; CGCAGATATCATTGAGGCCCAGTTA
>probe:Drosophila_2:1635271_at:13:299; Interrogation_Position=1484; Antisense; CGCATCCTAGGAAGAGGCTGCTCTA
>probe:Drosophila_2:1635271_at:372:525; Interrogation_Position=1527; Antisense; GGGACAATTACACCGAGTCGACCAC
>probe:Drosophila_2:1635271_at:22:433; Interrogation_Position=1541; Antisense; GAGTCGACCACCTATAACTTTAACA
>probe:Drosophila_2:1635271_at:33:55; Interrogation_Position=1603; Antisense; ATGACGCCACTTTCTTCGTAGTTAC
>probe:Drosophila_2:1635271_at:680:483; Interrogation_Position=1620; Antisense; GTAGTTACCCAATTCAAGCTGTCGA
>probe:Drosophila_2:1635271_at:254:119; Interrogation_Position=1636; Antisense; AGCTGTCGAAATATTCATTCTGTTT
>probe:Drosophila_2:1635271_at:666:427; Interrogation_Position=1745; Antisense; GAGATAATCTACTCATTACCACATA

Paste this into a BLAST search page for me
GATCGCTGCTCGAAGGCCTTCTTCAGAAGCCATTCGCCTGTGAGTACTGTGTGAGTACTGTGACAAGTGCTACCAAGTGCTACCAGAGCGTTGGCAACCTTGAATAACCACATGGTGCGCCTGCAATGGTGCGCCTGCACGCAGATATCACGCAGATATCATTGAGGCCCAGTTACGCATCCTAGGAAGAGGCTGCTCTAGGGACAATTACACCGAGTCGACCACGAGTCGACCACCTATAACTTTAACAATGACGCCACTTTCTTCGTAGTTACGTAGTTACCCAATTCAAGCTGTCGAAGCTGTCGAAATATTCATTCTGTTTGAGATAATCTACTCATTACCACATA

Full Affymetrix probeset data:

Annotations for 1635271_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime