Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635272_a_at:

>probe:Drosophila_2:1635272_a_at:726:79; Interrogation_Position=317; Antisense; AGGTGCAAACACTGCGTCCGTCAAC
>probe:Drosophila_2:1635272_a_at:34:495; Interrogation_Position=336; Antisense; GTCAACGGCATTCGGATCCAGTCAG
>probe:Drosophila_2:1635272_a_at:302:649; Interrogation_Position=357; Antisense; TCAGCGGCAGTACGTGGACTCCAAG
>probe:Drosophila_2:1635272_a_at:503:349; Interrogation_Position=381; Antisense; GCAGATGCGAAAGAGGCGCCCTCGT
>probe:Drosophila_2:1635272_a_at:290:503; Interrogation_Position=404; Antisense; GTCCCGCCAAGCTGCTGGGTGGAAA
>probe:Drosophila_2:1635272_a_at:638:537; Interrogation_Position=542; Antisense; GGTCAAGTATTACCCGTCCAGATGA
>probe:Drosophila_2:1635272_a_at:542:307; Interrogation_Position=582; Antisense; CCATCTACTATGTGGTGTCCAAGAC
>probe:Drosophila_2:1635272_a_at:499:211; Interrogation_Position=602; Antisense; AAGACCAACGGACGCTTCGGCAAGT
>probe:Drosophila_2:1635272_a_at:471:329; Interrogation_Position=653; Antisense; GCGGAGTTCGCCAAATATCTGGTGA
>probe:Drosophila_2:1635272_a_at:6:215; Interrogation_Position=677; Antisense; AAGAGCAAAGCGGAGCCCATTGGCC
>probe:Drosophila_2:1635272_a_at:588:273; Interrogation_Position=694; Antisense; CATTGGCCGGGATCAGCGATTCGAG
>probe:Drosophila_2:1635272_a_at:173:435; Interrogation_Position=716; Antisense; GAGGTGATCTTGTGATCTACCCGCT
>probe:Drosophila_2:1635272_a_at:251:297; Interrogation_Position=737; Antisense; CGCTCCATCTTCTCTAAGTCAAAGT
>probe:Drosophila_2:1635272_a_at:704:687; Interrogation_Position=818; Antisense; TATTGCCGCAATAAACCCATGTCTA

Paste this into a BLAST search page for me
AGGTGCAAACACTGCGTCCGTCAACGTCAACGGCATTCGGATCCAGTCAGTCAGCGGCAGTACGTGGACTCCAAGGCAGATGCGAAAGAGGCGCCCTCGTGTCCCGCCAAGCTGCTGGGTGGAAAGGTCAAGTATTACCCGTCCAGATGACCATCTACTATGTGGTGTCCAAGACAAGACCAACGGACGCTTCGGCAAGTGCGGAGTTCGCCAAATATCTGGTGAAAGAGCAAAGCGGAGCCCATTGGCCCATTGGCCGGGATCAGCGATTCGAGGAGGTGATCTTGTGATCTACCCGCTCGCTCCATCTTCTCTAAGTCAAAGTTATTGCCGCAATAAACCCATGTCTA

Full Affymetrix probeset data:

Annotations for 1635272_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime