FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635274_at:

>probe:Drosophila_2:1635274_at:558:373; Interrogation_Position=134; Antisense; GAAGTAACCAGCACACTTTGGATCC
>probe:Drosophila_2:1635274_at:129:275; Interrogation_Position=149; Antisense; CTTTGGATCCCCTGTACGAAGAAAT
>probe:Drosophila_2:1635274_at:442:543; Interrogation_Position=176; Antisense; GGATTCTTTGCATGATACCCTATAA
>probe:Drosophila_2:1635274_at:351:677; Interrogation_Position=207; Antisense; TAGTCCAGACACTGCCAAATACGTG
>probe:Drosophila_2:1635274_at:74:681; Interrogation_Position=282; Antisense; TATCGATGGCGAGTTGGAACCCTAT
>probe:Drosophila_2:1635274_at:173:561; Interrogation_Position=297; Antisense; GGAACCCTATGTGCCTGTGATTAAT
>probe:Drosophila_2:1635274_at:312:5; Interrogation_Position=30; Antisense; ATTGGGAGCTCGCAGCAGCCAGCCA
>probe:Drosophila_2:1635274_at:554:505; Interrogation_Position=307; Antisense; GTGCCTGTGATTAATTCCACGGATA
>probe:Drosophila_2:1635274_at:509:307; Interrogation_Position=323; Antisense; CCACGGATACATGGACTTTGGTCCA
>probe:Drosophila_2:1635274_at:55:233; Interrogation_Position=357; Antisense; AATGCAGGCCTATCTGTTCTATGCC
>probe:Drosophila_2:1635274_at:577:471; Interrogation_Position=372; Antisense; GTTCTATGCCGACCAAATCGATTGG
>probe:Drosophila_2:1635274_at:550:465; Interrogation_Position=391; Antisense; GATTGGTTCCTTAGAGTCGAGCCCT
>probe:Drosophila_2:1635274_at:206:677; Interrogation_Position=402; Antisense; TAGAGTCGAGCCCTCTAGATCATAA
>probe:Drosophila_2:1635274_at:416:127; Interrogation_Position=50; Antisense; AGCCACAGCGGTTACAGATGCAGAT

Paste this into a BLAST search page for me
GAAGTAACCAGCACACTTTGGATCCCTTTGGATCCCCTGTACGAAGAAATGGATTCTTTGCATGATACCCTATAATAGTCCAGACACTGCCAAATACGTGTATCGATGGCGAGTTGGAACCCTATGGAACCCTATGTGCCTGTGATTAATATTGGGAGCTCGCAGCAGCCAGCCAGTGCCTGTGATTAATTCCACGGATACCACGGATACATGGACTTTGGTCCAAATGCAGGCCTATCTGTTCTATGCCGTTCTATGCCGACCAAATCGATTGGGATTGGTTCCTTAGAGTCGAGCCCTTAGAGTCGAGCCCTCTAGATCATAAAGCCACAGCGGTTACAGATGCAGAT

Full Affymetrix probeset data:

Annotations for 1635274_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720